ID: 1162256481

View in Genome Browser
Species Human (GRCh38)
Location 19:9494256-9494278
Sequence AGAATCAAAGTGTGTATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162256478_1162256481 22 Left 1162256478 19:9494211-9494233 CCCTTCAATCTTGTTAAGTGGAA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG 0: 1
1: 0
2: 1
3: 19
4: 233
1162256479_1162256481 21 Left 1162256479 19:9494212-9494234 CCTTCAATCTTGTTAAGTGGAAA 0: 1
1: 1
2: 0
3: 18
4: 250
Right 1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG 0: 1
1: 0
2: 1
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162256481 Original CRISPR AGAATCAAAGTGTGTATAGA TGG Intronic
900535828 1:3176792-3176814 TGAATCAAGGGGTGGATAGATGG - Intronic
906384522 1:45356177-45356199 AGATTCAAAATGTATTTAGATGG + Intronic
906945915 1:50294156-50294178 AGAGTCAAAGTGTCTACAAATGG - Intergenic
907465756 1:54635484-54635506 AGAATAAAAGAGTATCTAGAAGG + Exonic
908870002 1:68599327-68599349 AGAAGCAAAGAATGTACAGATGG - Intergenic
909160745 1:72146537-72146559 TGAAACAAAGTTTGTATATATGG - Intronic
909226928 1:73037170-73037192 AGAAGCAAAGTATGTATACATGG - Intergenic
911989469 1:104674749-104674771 AGAGTAAAAGTGTACATAGAAGG - Intergenic
918674691 1:187268472-187268494 AAAATCAGAGTGTGGAAAGAAGG - Intergenic
918907936 1:190523899-190523921 AAAAAAAAAGTGTGTATAAAGGG - Intergenic
922119341 1:222647576-222647598 AGAATCAAAGGGTAAATGGAAGG + Intronic
922474324 1:225896776-225896798 AGAAGTAGAGTGTGTAGAGATGG + Intronic
1063565061 10:7165387-7165409 AAAGGCAAAGTGTGTATAAATGG + Intronic
1065082813 10:22143988-22144010 AGAATAAATGTGTATACAGATGG + Intergenic
1068111726 10:52688266-52688288 AGAAAAAAAGTGTGTATTGCAGG + Intergenic
1068791199 10:61033337-61033359 AGAATCAAATATTGCATAGATGG - Intergenic
1069362941 10:67664060-67664082 AGATTAAAAGTGTGAAAAGAAGG + Intronic
1070749875 10:78957736-78957758 AGAATCAATGTGTGCATAAAAGG + Intergenic
1072533617 10:96342804-96342826 AGAATCATAGAGGGTATAGAAGG + Intergenic
1073040755 10:100603379-100603401 GGAATAAAAATGTGAATAGAAGG + Intergenic
1073404946 10:103289235-103289257 AGAACCAAAATGTGTTTAAAAGG - Exonic
1075486333 10:122824335-122824357 AGAGGCAAAGTGCTTATAGATGG + Intergenic
1077763957 11:5136644-5136666 AGAATAAAACTGGGTATTGAGGG + Intergenic
1078423743 11:11233029-11233051 AGAATCAAAGGGGAAATAGAGGG + Intergenic
1078651100 11:13193327-13193349 AAAATCAAATTGTGTTTACAAGG + Intergenic
1079185045 11:18229078-18229100 AGAATCAGAAGGTGTGTAGATGG + Intronic
1081424355 11:42908816-42908838 AGAATCAAAGTATTTAGAGATGG - Intergenic
1084872060 11:72105086-72105108 AAAATGAAAGAGTGTATGGATGG - Intronic
1085628440 11:78091562-78091584 AGCATCAGAGTGTATATATAAGG - Intergenic
1086616660 11:88829889-88829911 AGAACCAAAGTATATATTGAGGG + Intronic
1086839099 11:91663113-91663135 TGAATCTAAATGTTTATAGATGG + Intergenic
1087038395 11:93775552-93775574 AGAATTAAAGTGTTAATAAAAGG - Intronic
1087604284 11:100357376-100357398 AGAATCAAACAGTGCATAGCTGG - Exonic
1089828707 11:121305209-121305231 AGAATCATAGTATTTATTGAAGG + Intronic
1091018371 11:132075146-132075168 AGAATCAAAGAGTGGAATGATGG + Intronic
1091255366 11:134179938-134179960 AGAATGAAACTATGTATATAGGG + Intronic
1091903933 12:4167572-4167594 ATAATAAAGGTGTGTATACAAGG - Intergenic
1092574488 12:9764906-9764928 AGATGCAAAGTGTGCAGAGAAGG + Intergenic
1092904112 12:13086680-13086702 AGAATAAAAATGGATATAGAAGG + Intronic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1094067000 12:26371877-26371899 AGTATCAAAGAGTCTATAGCAGG - Intronic
1094562800 12:31571224-31571246 AGAATGAAAATATGTTTAGACGG - Intronic
1097674910 12:62589765-62589787 AGAACCAGAATGTGTATAAAGGG + Intronic
1098997504 12:77137897-77137919 GGAGTCAAAATGTGTATTGATGG + Intergenic
1099422356 12:82477299-82477321 AGAATCAAAGTCTCTATACAGGG - Exonic
1100403608 12:94253317-94253339 TGAATAAATGAGTGTATAGAAGG - Intronic
1100873599 12:98939231-98939253 AGAATCAGAGTGAATATAGCTGG + Intronic
1102498828 12:113337393-113337415 AGGCTCTAAGTGTTTATAGAAGG - Intronic
1104468383 12:129008335-129008357 AGAATCAAAATGTTTATAATAGG - Intergenic
1105850030 13:24325989-24326011 TGAATTAAAGTTTGTATATACGG - Intergenic
1107864482 13:44690475-44690497 AGAATGAACGTGTGCATAGATGG - Intergenic
1109723719 13:66312212-66312234 GGAATAAAAGAATGTATAGAGGG - Intronic
1110087498 13:71399870-71399892 AGAATCATAGTGTGAAATGAAGG - Intergenic
1110305987 13:73987551-73987573 AGAATGAAAATGTGTAAACAGGG + Intronic
1111084692 13:83359777-83359799 AGACTCAAAATGTTTATGGAAGG + Intergenic
1113088762 13:106595648-106595670 AGAATCGAAGTCTTTCTAGAAGG + Intergenic
1114513759 14:23284300-23284322 AGAATTCAAGTGCGTCTAGAAGG + Intronic
1114972172 14:28046174-28046196 ACAATCACAGTGTGTATGGCTGG - Intergenic
1115180293 14:30617696-30617718 AGAAGTAAAGAGTTTATAGAAGG - Exonic
1115238255 14:31229070-31229092 AGTATCACACTGTGTACAGAGGG + Intergenic
1117435014 14:55707791-55707813 AGAATCACAGTGGGGAAAGAAGG - Intergenic
1117544006 14:56776069-56776091 TAAATCAAAGTGTATACAGATGG - Intergenic
1117563620 14:56970563-56970585 AGATTCAGAGTGTGTTTTGAAGG + Intergenic
1118110933 14:62719011-62719033 AGAATCAGAGAGTATATAAATGG + Intronic
1118812270 14:69284085-69284107 AGGGTCAAAGTTTGTATAGCAGG - Intronic
1120028418 14:79612173-79612195 ATAAACAAAGTGTGCAAAGAAGG - Intronic
1124995531 15:34719919-34719941 AAGACCAAAGTGTGTATAGTGGG + Intergenic
1126130497 15:45336787-45336809 AGAATCAAAGAATGAAAAGATGG + Intergenic
1130245777 15:82247197-82247219 AGAATCAAAGATTGTAGAGAAGG + Intronic
1130454925 15:84096182-84096204 AGAATCAAAGATTGTAGAGAAGG - Intergenic
1131686533 15:94773855-94773877 AATATGAATGTGTGTATAGATGG - Intergenic
1133305401 16:4805103-4805125 AGTCTCAAAGTCTGTATAAAAGG + Exonic
1137624235 16:49897521-49897543 CGAATCCAAGTGTGTTTAGAGGG - Intergenic
1138712009 16:58980658-58980680 ACATTCAAAGCGTGTGTAGAGGG - Intergenic
1141221720 16:82076206-82076228 AAAAAAAAACTGTGTATAGAAGG + Intronic
1145275856 17:21429864-21429886 AGAATGAAGGTGTGCACAGAGGG + Intergenic
1145313703 17:21715773-21715795 AGAATGAAGGTGTGCACAGAGGG + Intergenic
1149137188 17:53381468-53381490 AGCACCAAAGTGCGTATAGATGG + Intergenic
1151378788 17:73710525-73710547 AGAATAAAAGTGTGTGTCCAGGG + Intergenic
1153985733 18:10349569-10349591 AGAATGAAAGTGCGTATAATTGG - Intergenic
1154406899 18:14100660-14100682 AGAATCAGAGTGGGTATGGTGGG + Intronic
1155090233 18:22501825-22501847 AGAAACAAATTGTTGATAGATGG + Intergenic
1155796128 18:30039176-30039198 AGAAAAAAATTGTGGATAGAAGG + Intergenic
1156074487 18:33257205-33257227 ATCATCAAAGTGTTTTTAGAAGG - Intronic
1156121674 18:33850604-33850626 AGAAGCAAAGGGAGTAAAGAAGG - Intergenic
1156330414 18:36116301-36116323 AGAAAAAAAGTGTGTGTAGCTGG + Intronic
1159435276 18:68408488-68408510 GGGATGAAAGTGTGTATGGATGG + Intergenic
1159555680 18:69942242-69942264 AGAACCAATGTGTATATACATGG - Intronic
1161832833 19:6621708-6621730 AGCAACAAAGTAGGTATAGAAGG + Intergenic
1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG + Intronic
1165566732 19:36735926-36735948 CTCATCAAAGTGGGTATAGAAGG + Intronic
1168071129 19:53952494-53952516 AGAAAAAAAGAGTGGATAGAGGG + Intergenic
927303107 2:21538497-21538519 TTCATCAAAGTGGGTATAGAGGG + Intergenic
928796690 2:35032086-35032108 AGACTCAAAGTATATATAAATGG + Intergenic
929044243 2:37775024-37775046 AGGAGCAAAGTGGGTACAGATGG + Intergenic
929785596 2:44988596-44988618 AAAATCAGAGTGTGAAAAGATGG - Intergenic
933099808 2:78239528-78239550 TGAAACAAAGTGTGTGTACATGG - Intergenic
933974307 2:87496106-87496128 AGAACAAAAGTCTGTATAAATGG - Intergenic
935171326 2:100613107-100613129 AGAATCAAACTTTCTATAGAGGG + Intergenic
935450508 2:103203525-103203547 ACATTTAAAGTGTGTGTAGAGGG + Intergenic
936045330 2:109183637-109183659 AGAATCAAAGAGTGAGTGGACGG - Intronic
936319518 2:111454713-111454735 AGAACAAAAGTCTGTATAAATGG + Intergenic
937211064 2:120271520-120271542 AGAATCAAAGTTTCTTAAGATGG + Intronic
939663140 2:144915515-144915537 ATATTCAAAGTGTGTTTAAAGGG - Intergenic
940899124 2:159110267-159110289 AAAAGCATAGTGTGTATACAGGG + Intronic
941022913 2:160428717-160428739 AGAATAAATCTGTCTATAGATGG + Intronic
942230336 2:173855175-173855197 GGAATCAATTTGTGTTTAGAAGG - Intergenic
944700639 2:202242999-202243021 GAAATCAAAGTCTGTTTAGAAGG - Intergenic
944889541 2:204103009-204103031 AGAATGAAAGAATCTATAGAGGG + Intergenic
944929027 2:204497244-204497266 GGAATCAAAGTGTATTGAGAAGG + Intergenic
945416062 2:209574495-209574517 ACAATCTAAGTGTCTGTAGATGG - Intronic
946350238 2:219146195-219146217 AAAATCACAGTGTTTATACAAGG - Intronic
948255002 2:236561112-236561134 AGAATCAAAGAGTGGAATGATGG + Intergenic
1168875527 20:1169491-1169513 AGAGTCACAGTGGGTTTAGAGGG + Intronic
1169040061 20:2486262-2486284 AGAATCATAGTGAGTATACATGG - Intronic
1169313300 20:4566680-4566702 AGAATCTAAGTGTCTATCAATGG + Intergenic
1174621365 20:51877286-51877308 AGAATCAAAGTGTGGAATGGTGG + Intergenic
1175211042 20:57355288-57355310 ATAAGCAAAGGGTGTAAAGAGGG + Intronic
1176875997 21:14129835-14129857 AGAATCAAATTGTTTAAGGAAGG - Intronic
1182368161 22:29792488-29792510 AGAACCAAAGTGCCTAGAGAAGG - Exonic
1182649538 22:31840000-31840022 AGAATCAATGTGTGAATAAATGG - Intronic
1182862475 22:33571915-33571937 AGAATGAAAATGTGTCTGGAGGG - Intronic
1203296358 22_KI270736v1_random:46411-46433 AGGAGCAAAGTGGGTACAGATGG + Intergenic
949259377 3:2087287-2087309 AGAATCAAAGGGTGAATAGGTGG + Intergenic
949698999 3:6734214-6734236 AGAATCCATGTGTGTCTGGAGGG - Intergenic
951192963 3:19791640-19791662 AGAATTAAAATGTGTACAAAAGG + Intergenic
952136101 3:30422386-30422408 AGAGAGAAAGTGTGTTTAGATGG + Intergenic
954046988 3:47940511-47940533 AGAATCAAAGTCTCTAGGGATGG - Intronic
955056085 3:55457279-55457301 AGTATGTGAGTGTGTATAGAAGG + Intergenic
957188246 3:76971432-76971454 ATTATCAATTTGTGTATAGATGG + Intronic
959393231 3:105802681-105802703 AGATTGAAGGTGTGTCTAGATGG - Intronic
960156464 3:114301575-114301597 AGAATCAAAGGCTCTTTAGAAGG + Intronic
960408526 3:117292390-117292412 AGATTCAAAGGGTCTCTAGAAGG + Intergenic
960476295 3:118133182-118133204 ATAAATAAACTGTGTATAGATGG + Intergenic
960767107 3:121144965-121144987 AGAATCAAAGAGTGTAATGGTGG + Intronic
962106003 3:132390213-132390235 AGAAGTAAAGAGTTTATAGAAGG - Intergenic
964100088 3:152978632-152978654 AGATCCAAAGTGTGTTTTGAAGG - Intergenic
964850460 3:161090734-161090756 TGAAACAAATTGTGTATATAAGG - Intronic
965450278 3:168830252-168830274 ACATTGAAAGTGAGTATAGAAGG - Intergenic
967938299 3:194746937-194746959 AGAATCTGAGTGTGTATAAGGGG + Intergenic
970711014 4:18862356-18862378 AGAATCAAGGTATGTTCAGAAGG - Intergenic
971434362 4:26604531-26604553 ATAATCCAAATGTCTATAGATGG - Intronic
971568785 4:28183188-28183210 TTCATCAAACTGTGTATAGAAGG - Intergenic
971762768 4:30789581-30789603 AAAATGAAAGCATGTATAGAGGG + Intronic
973663563 4:53134136-53134158 AGAATCAAAGAGTGAAATGATGG + Intronic
974438906 4:61892274-61892296 ATTATCAAACTTTGTATAGAAGG - Intronic
974464904 4:62242473-62242495 AGAATCAAACTGTTTAAGGAAGG - Intergenic
976381486 4:84404355-84404377 TGAAACACAGTGTGTAAAGAAGG + Intergenic
976928391 4:90531250-90531272 ACAATCAATGTGTTTATACAGGG - Intronic
977005191 4:91559335-91559357 AAAATCAAAGCGTGTATAATTGG + Intronic
977033723 4:91922701-91922723 ATAATTAAAGTGATTATAGATGG - Intergenic
977464453 4:97366086-97366108 AGAGTCAAAATGTGTATACTAGG - Intronic
978412252 4:108438575-108438597 ACATTCAAAGCGTGTGTAGAGGG - Intergenic
978936603 4:114385072-114385094 AGAATCAAAATGTAAATAGTGGG - Intergenic
979658285 4:123222720-123222742 AGAATCAAAGAGTAGAAAGATGG - Intronic
979681284 4:123462765-123462787 ACAAACAATTTGTGTATAGATGG + Intergenic
981888378 4:149706412-149706434 TAAATCAGAGTGTGTCTAGATGG + Intergenic
982282901 4:153704066-153704088 AAAATTAAAGTTTGTAGAGAGGG - Exonic
982322661 4:154095984-154096006 AGAAGCCCAGTGTATATAGAGGG + Intergenic
982419181 4:155174263-155174285 AGAATTAAAGTGTATATACCAGG + Intergenic
982860792 4:160446522-160446544 ACAAGCTAAGTGTCTATAGAAGG - Intergenic
982901184 4:161004253-161004275 AGAGAAAGAGTGTGTATAGAAGG + Intergenic
985352044 4:189074486-189074508 AGAATCTAAGGGTTTATGGAGGG - Intergenic
985468313 5:19411-19433 AGAATAAAAGTGTTTACAGGGGG + Intergenic
985850464 5:2384888-2384910 AGAATCAAAGGTTGTAGAGGCGG - Intergenic
985958329 5:3281187-3281209 AGAAGGAAAGTGTGGAGAGATGG + Intergenic
988024563 5:25668545-25668567 GGGATCAAAGTGTCTTTAGATGG + Intergenic
988048043 5:25984990-25985012 AGAATCAGAGAGTGGATTGATGG - Intergenic
988199563 5:28051097-28051119 AGAATAAGAGTGAGTATAAAAGG - Intergenic
988905765 5:35787003-35787025 AGCATCAAAGAATGTGTAGAAGG + Intronic
989223659 5:38999235-38999257 AGATCCAACATGTGTATAGATGG + Intronic
989750910 5:44892411-44892433 AAAAAAAAACTGTGTATAGAGGG - Intergenic
993180344 5:84544480-84544502 AGAAAAAAAGTGTATATATATGG - Intergenic
994400224 5:99270262-99270284 AGCAACAAAGTGTGCATTGAGGG - Intergenic
995140680 5:108732095-108732117 AAATACAAAGTCTGTATAGAGGG + Intergenic
996040364 5:118802688-118802710 ATTATCAAACTGGGTATAGAAGG + Intergenic
996447969 5:123579832-123579854 AGAAGCAGAGTGTTTATAAATGG - Intronic
997027278 5:130080226-130080248 ATAATGAAAGTGTGTATTGGAGG - Intronic
997987916 5:138518646-138518668 ATAACCAAAATGTGTAGAGAAGG + Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998728431 5:145045464-145045486 AGAATCAAAGTTTTTATCAAAGG + Intergenic
998795899 5:145818589-145818611 AGATTCAGAGTGAGTATATAGGG + Intronic
999008702 5:148010824-148010846 TAAATCAATGTGTGTATTGATGG - Intergenic
999676859 5:154013193-154013215 AGAATAAAAATGTGTAAGGATGG + Intronic
999745480 5:154588630-154588652 AGAAGCAGAGTCTGTATGGAGGG - Intergenic
1000443384 5:161289557-161289579 ACAGTAAAAGTTTGTATAGATGG - Exonic
1000586747 5:163109394-163109416 AGTATCAAAGTGTATAAGGATGG - Intergenic
1000744047 5:165008277-165008299 TGAATCAAAATGTGGTTAGATGG + Intergenic
1001704406 5:173731298-173731320 AGAAACACAGTGTTTAAAGAAGG - Intergenic
1001768156 5:174271352-174271374 GGAATAAAAGTGTGAATAAAAGG - Intergenic
1002843979 6:929732-929754 AGAACCAAACTGTGTACATAAGG + Intergenic
1003215615 6:4106882-4106904 AGAATCAAAGAGCGTAATGATGG - Intronic
1004781989 6:18919609-18919631 AAAATCAATTTGTGTATAGGTGG + Intergenic
1005271497 6:24169446-24169468 ATAATCAAAATGTGTTTAGATGG - Intergenic
1006093157 6:31640120-31640142 GGAATCAAACTATGTAGAGATGG - Intronic
1011040342 6:83022998-83023020 AGAATCAAAGTATTTACATAAGG + Intronic
1011111586 6:83842924-83842946 ATAATCAAAGTGAATATAGCTGG - Intergenic
1012115341 6:95289815-95289837 AGAAACAAAATGTGGATAAAAGG - Intergenic
1013296346 6:108761397-108761419 AGCATCTAAGTGGGTACAGAGGG - Intergenic
1015192767 6:130489569-130489591 ACAAGCAAAGTGCCTATAGAGGG + Intergenic
1016659688 6:146563691-146563713 AAAATCAAAGTTTATATAAAGGG - Intergenic
1017131127 6:151109019-151109041 AGAATCAAAGCGTGGATACAAGG - Intergenic
1018724865 6:166604010-166604032 TGAAACAAAGTGTGTAAAGGTGG + Intronic
1019069519 6:169332010-169332032 AGACAAATAGTGTGTATAGACGG + Intergenic
1023683414 7:42711961-42711983 AGAATCATAGGATGTATGGATGG + Intergenic
1028084398 7:86618346-86618368 AGAATCAAAGTGTGCAATAATGG + Intergenic
1030010345 7:105159671-105159693 AGAATGAAAGTATGCGTAGATGG - Intronic
1030069866 7:105689275-105689297 AGAATCAAAGTGAGGAAGGAGGG + Intronic
1031935372 7:127730668-127730690 AAAATCAAACTGAGTAGAGAAGG - Intronic
1032415304 7:131730988-131731010 AGAATCAAGGTGGATATGGAGGG - Intergenic
1035514232 8:218977-218999 AGAATAAAAGTGTTTACAGGGGG + Intergenic
1037137038 8:15475071-15475093 AGCAGCAAACTGTGTATAAAGGG - Intronic
1038481705 8:27906452-27906474 GGAATAAAAGAGTATATAGAAGG + Intronic
1038890690 8:31719361-31719383 AAAATTAAACTGAGTATAGAAGG + Intronic
1039011328 8:33096581-33096603 ATAATTAAAGTGTCTACAGATGG + Intergenic
1039086394 8:33784286-33784308 AAAATGTATGTGTGTATAGAGGG - Intergenic
1042563326 8:70089970-70089992 AGCATGAAAGTGTGAAGAGAGGG - Intergenic
1044172834 8:89077359-89077381 AGAAACAAAAGATGTATAGAAGG - Intergenic
1044373623 8:91444131-91444153 AGAATCAAAGTGACTAAAAAAGG + Intergenic
1045585499 8:103530028-103530050 AGGATAAATGTGTGGATAGATGG + Intronic
1047173599 8:122519001-122519023 AGAATTAAAATGTGCATTGATGG - Intergenic
1048612455 8:136038288-136038310 AGAATCAAAGTGTATAAAAATGG - Intergenic
1051217326 9:14812536-14812558 AGAATCATAGGGTGAATGGAAGG + Intronic
1051289407 9:15529994-15530016 AGCATCAAAGTGTGAAAATAAGG + Intergenic
1051764544 9:20508375-20508397 AGAATGAAAGTGTTTACAGATGG + Intronic
1052337131 9:27331417-27331439 AGAATCAATGTGTGCACAGGAGG - Intronic
1052342027 9:27373338-27373360 ACAAACAAAGGGTGTATAGTGGG - Intronic
1052725048 9:32219278-32219300 AGTATTAAAGTGTTTCTAGAAGG + Intergenic
1053577543 9:39368465-39368487 AGAATGTAGGTGTGTATATAGGG - Intergenic
1053842050 9:42196417-42196439 AGAATGTAGGTGTGTATATAGGG - Intergenic
1054099119 9:60927182-60927204 AGAATGTAGGTGTGTATATAGGG - Intergenic
1054120518 9:61202806-61202828 AGAATGTAGGTGTGTATATAGGG - Intergenic
1054587232 9:66979750-66979772 AGAATGTAGGTGTGTATATAGGG + Intergenic
1055939483 9:81636035-81636057 AGAATGAAAGTTTATAAAGATGG - Intronic
1058120475 9:101133146-101133168 TGGATCAAAGTGGGTATTGATGG - Intronic
1058356385 9:104088417-104088439 AGAAGAAAAGTGTGGATAAAGGG + Intergenic
1058769043 9:108212529-108212551 AGGATGAAAGAGTGTTTAGATGG - Intergenic
1059831850 9:118104931-118104953 AGGAAGAAAGTGTATATAGATGG - Intergenic
1060037858 9:120273204-120273226 ACATTTAAAGTGTGTGTAGAGGG - Intergenic
1061455488 9:130694355-130694377 AGATTCAAAATGTGTATAAATGG - Intronic
1062504860 9:136868028-136868050 AGAAGCAAGGTTTGTATGGACGG - Intronic
1185984772 X:4819624-4819646 AGAAGTACAGTGTATATAGAAGG - Intergenic
1187794242 X:22984429-22984451 AGAATCAAAGAGTGAAATGAAGG + Intergenic
1189254601 X:39628077-39628099 ACAATCAAAGTGTGTATCGATGG + Intergenic
1191637151 X:63391979-63392001 AGAATAAAAATGTGTAAAGGTGG - Intergenic
1194686317 X:96922150-96922172 AGGGTCACAGTGTGAATAGAAGG + Intronic
1194875981 X:99188036-99188058 TTAATCAAAGTGTGCATGGAAGG + Intergenic
1195607244 X:106821055-106821077 AGGATCAAAGTTTGCATGGAAGG + Intronic
1197094614 X:122578504-122578526 TGGATCAAAGTGTGGACAGAAGG - Intergenic
1197459030 X:126715966-126715988 ATAATCAAAGTGTATGTAAACGG - Intergenic
1199245244 X:145597086-145597108 CTAATCAAACTGGGTATAGAAGG + Intergenic
1199470802 X:148193405-148193427 AGAATAAAAGTCTTTCTAGAGGG - Intergenic
1200775819 Y:7169438-7169460 AGCATCTAAGTGTATATACAGGG - Intergenic
1201891237 Y:18946115-18946137 AGAATAAGAGTGAGTATAAAAGG + Intergenic