ID: 1162261764

View in Genome Browser
Species Human (GRCh38)
Location 19:9539794-9539816
Sequence GGGGGACTCCCTTGGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162261760_1162261764 -8 Left 1162261760 19:9539779-9539801 CCGAAACCTGGGACAGGGGGACT No data
Right 1162261764 19:9539794-9539816 GGGGGACTCCCTTGGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162261764 Original CRISPR GGGGGACTCCCTTGGGAGAC TGG Intergenic
No off target data available for this crispr