ID: 1162263777

View in Genome Browser
Species Human (GRCh38)
Location 19:9553177-9553199
Sequence CAGTTTATGCAGAAATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162263777_1162263781 7 Left 1162263777 19:9553177-9553199 CCTACAAATTTCTGCATAAACTG No data
Right 1162263781 19:9553207-9553229 ATCTACATGTAATTAAAAGTAGG 0: 13
1: 44
2: 168
3: 258
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162263777 Original CRISPR CAGTTTATGCAGAAATTTGT AGG (reversed) Intergenic
No off target data available for this crispr