ID: 1162264015

View in Genome Browser
Species Human (GRCh38)
Location 19:9555235-9555257
Sequence AACGTGATGAAAAGTGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162264012_1162264015 21 Left 1162264012 19:9555191-9555213 CCATCTCAAAAAATAAAATAAAA 0: 789
1: 1249
2: 93360
3: 76520
4: 90219
Right 1162264015 19:9555235-9555257 AACGTGATGAAAAGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162264015 Original CRISPR AACGTGATGAAAAGTGTGCT TGG Intergenic
No off target data available for this crispr