ID: 1162265222

View in Genome Browser
Species Human (GRCh38)
Location 19:9567807-9567829
Sequence AATCGAATGCTGCTACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162265219_1162265222 20 Left 1162265219 19:9567764-9567786 CCCTCGCATGGGTGGTTCACAGT 0: 1
1: 1
2: 13
3: 125
4: 572
Right 1162265222 19:9567807-9567829 AATCGAATGCTGCTACTGACAGG 0: 1
1: 0
2: 3
3: 18
4: 71
1162265220_1162265222 19 Left 1162265220 19:9567765-9567787 CCTCGCATGGGTGGTTCACAGTA 0: 1
1: 1
2: 10
3: 123
4: 554
Right 1162265222 19:9567807-9567829 AATCGAATGCTGCTACTGACAGG 0: 1
1: 0
2: 3
3: 18
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162265222 Original CRISPR AATCGAATGCTGCTACTGAC AGG Intronic
914660822 1:149789656-149789678 AATCTAATGTTGCCACTGATTGG - Intronic
916689951 1:167180545-167180567 AATGGCGTGCTGCTGCTGACGGG - Intergenic
1068306563 10:55217996-55218018 AGAGGAATGCTCCTACTGACAGG - Intronic
1075347083 10:121690814-121690836 AATCGACTGATACAACTGACAGG + Intergenic
1080650262 11:34216873-34216895 AATGGAAAGCTGCTTCTGCCCGG - Intronic
1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG + Intergenic
1084804216 11:71567515-71567537 AAGCGACTGCTGATACTGCCGGG + Intronic
1084806216 11:71581055-71581077 AAGCGACTGCTGATACTGCCGGG - Intronic
1087037991 11:93773495-93773517 AAGTGACTGCTCCTACTGACTGG - Intronic
1090887034 11:130886615-130886637 TATAGATTGCTGCTACTGATTGG - Intronic
1095323857 12:40863655-40863677 AATCTAATGCTACTATTGACAGG - Intronic
1097308136 12:58091338-58091360 AATCTAATGCTGCTGCTGATCGG + Intergenic
1097809919 12:64007407-64007429 AATCTAATGCTGCGGCTGATCGG + Intronic
1101741370 12:107502706-107502728 AATCTAATGCTGCCACTGATCGG - Intronic
1102907211 12:116686004-116686026 AATCAAATGATGCTACTGGATGG + Intergenic
1109008467 13:56909507-56909529 AATCAAATGCTGCTATTTCCAGG + Intergenic
1115994149 14:39177894-39177916 AATCCACTGTTGCTACTGAAAGG + Exonic
1116159282 14:41248312-41248334 AACTGAATTCTGCTAATGACCGG - Intergenic
1120493467 14:85205052-85205074 AAACGAGTGCTGGAACTGACTGG - Intergenic
1120868657 14:89317840-89317862 AATCTAATGCTGCAGCTGATGGG - Intronic
1121945668 14:98119404-98119426 AATGAGATGCTACTACTGACTGG + Intergenic
1122030426 14:98907943-98907965 AGTCGAATGCTGCAACTCCCCGG - Intergenic
1132130737 15:99276001-99276023 AATCTAATGCTGCTGCTGATGGG - Intronic
1141861478 16:86719537-86719559 AATCGCATGCTGCCTCTGATCGG + Intergenic
1146120894 17:30193479-30193501 AATCTAATGCTGCCGCTGATGGG - Intergenic
1151331637 17:73413171-73413193 AATCGAATGCTGCCACTGATGGG - Intronic
1203188902 17_KI270729v1_random:158875-158897 AATCGAATGGTGTTATTGAATGG - Intergenic
1203189833 17_KI270729v1_random:170932-170954 AATCGAATGGTGTTATTGAATGG - Intergenic
1155736087 18:29224221-29224243 AATCTAATGCTGCTGATGATCGG - Intergenic
1162175406 19:8826539-8826561 AATCGAATGCTGCCACTGATCGG + Intronic
1162265222 19:9567807-9567829 AATCGAATGCTGCTACTGACAGG + Intronic
1163999521 19:21084072-21084094 AATCAGATGCTGGTACTGAGGGG + Intronic
1164291639 19:23874722-23874744 AATCTAATGCTGCTGCTGATCGG + Intergenic
1164710787 19:30355744-30355766 AATCTAATGCAGCCACTGACAGG - Intronic
1166848496 19:45745414-45745436 ATTTGAATGCTGCCACTGAAAGG - Intronic
1168431831 19:56287627-56287649 AATCGAATGTAGCCACTGTCAGG + Intronic
925821963 2:7807727-7807749 ATTCGAATGCTACTATTGATGGG + Intergenic
926057379 2:9782014-9782036 AATCTCAAGCTACTACTGACTGG + Intergenic
930656240 2:54009779-54009801 AATGGAATACTGATACTAACTGG + Intronic
930817065 2:55609021-55609043 CATCGAGTGCTGCTTCTGGCTGG - Intronic
931756424 2:65378692-65378714 AATCGAGTGCAGTTACTTACTGG - Intronic
933572019 2:84025177-84025199 AATCAAATTCTGCTAAGGACTGG + Intergenic
934255566 2:91411722-91411744 AATCGAAAGCAGTTACTGATTGG + Intergenic
936953883 2:118005193-118005215 AATGGAATGCTGCCACTGATGGG + Intronic
936988852 2:118340617-118340639 AATTGAGTGCCGTTACTGACAGG + Intergenic
939077094 2:137616741-137616763 GAATGAATGCTACTACTGACTGG + Intronic
939278079 2:140027580-140027602 AATCTAATGCCGCTGCTGACTGG - Intergenic
940983638 2:160030345-160030367 AATCGAATGGTGCTATTGAAAGG - Intronic
941403778 2:165063538-165063560 AATCTAATGCTGCTGCTGATGGG + Intergenic
944947031 2:204699900-204699922 TATGGAATGCAGCTTCTGACTGG + Intronic
947929914 2:233955884-233955906 AATCGAATACCGCCACTGATCGG - Intronic
1168784048 20:522081-522103 AATCTAATGCTGTTGCTGATGGG - Intronic
1170911493 20:20574988-20575010 AATCAAATGCTGCTGAGGACTGG - Intronic
1177416441 21:20799284-20799306 AATCTAATGCTGCCACTGATCGG - Intergenic
1178594821 21:33943696-33943718 AATCAAGTCCTGCTACTGCCAGG + Intergenic
1180527314 22:16305897-16305919 AATCGAATGGTGCAACCGAATGG - Intergenic
1180897242 22:19345681-19345703 AATTTAATGTTGCTGCTGACTGG + Intronic
1182779859 22:32858890-32858912 AGTCTAATTCTGCTACTTACTGG + Intronic
1203322555 22_KI270737v1_random:81747-81769 AATCGAATGGTGCAACCGAATGG + Intergenic
951505656 3:23442308-23442330 AAATGAATCCTGCTACTGATGGG + Intronic
959800431 3:110487527-110487549 TATTGAATGGTGCTACTGGCTGG - Intergenic
962247437 3:133807629-133807651 AAATGAATGCTGCTTCCGACAGG - Intronic
964790190 3:160446761-160446783 AATCTAATGCTGACACTGGCAGG - Intronic
965492432 3:169355059-169355081 AATTGAATGCTGCAACTGCAAGG - Intronic
967643009 3:191889977-191889999 GAAGGAATGCTGTTACTGACAGG - Intergenic
968414209 4:415772-415794 AATGGAATGCTGATACTGAGGGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
986035640 5:3934540-3934562 AATCGAATGATGATCTTGACTGG - Intergenic
989483529 5:41961515-41961537 CATCACATGCTGTTACTGACAGG - Intergenic
1001356293 5:171026946-171026968 AATCTAATGCTGTCGCTGACAGG - Intronic
1003908051 6:10720404-10720426 AAGCGAAGGCTGCTAGTGAGAGG + Intergenic
1007804133 6:44425479-44425501 AATGGACTGCAGCTACTGAAAGG - Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1017682720 6:156880247-156880269 AATGGAATGCTGGTAGTGAAAGG + Intronic
1020763673 7:12295836-12295858 AATTGAATGCTGCTTCTTCCAGG + Intergenic
1021040119 7:15851289-15851311 AATCTAATGCCGCCACTGAGCGG - Intergenic
1025559434 7:62352397-62352419 AATCGAATGCCACAACTGAATGG + Intergenic
1026498536 7:70923584-70923606 GATTGAATGCTGCTACTTTCAGG + Intergenic
1031282132 7:119818176-119818198 AATGGAATGCTGATAATGATTGG + Intergenic
1031346311 7:120671314-120671336 AATCTAATGCTGTTTCTGATTGG + Intronic
1034635118 7:152561059-152561081 AATCTAATGCCGCCACTGATTGG - Intergenic
1036826963 8:11984639-11984661 AATCGAATGGTGCAACTGAGAGG - Intergenic
1037411471 8:18603015-18603037 AACCTAATGCAGCAACTGACAGG + Intronic
1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG + Intergenic
1051378623 9:16431874-16431896 AATCTAATGCCACCACTGACAGG + Intronic
1051628646 9:19122703-19122725 AATCTAATGCCGCCTCTGACTGG - Intronic
1052439274 9:28473282-28473304 AATTGAATGCTGCTACTCATTGG - Intronic
1057868419 9:98699891-98699913 AATAGAATGCAGCTGCTTACTGG + Intronic
1061351365 9:130067709-130067731 AATAGAAGGCAGCTAATGACTGG + Intronic
1186880393 X:13859937-13859959 AAAGGAATGATGCAACTGACAGG - Intronic
1188065920 X:25659162-25659184 AATCTAATGCTGCCACTGATCGG + Intergenic