ID: 1162267076

View in Genome Browser
Species Human (GRCh38)
Location 19:9584470-9584492
Sequence GGTGGACTCCACCACGATAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 45}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162267060_1162267076 27 Left 1162267060 19:9584420-9584442 CCCCCCGCTATCTCCGGGATCCC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267069_1162267076 6 Left 1162267069 19:9584441-9584463 CCCAAGCAGGCGGAACTCACCAC 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267061_1162267076 26 Left 1162267061 19:9584421-9584443 CCCCCGCTATCTCCGGGATCCCC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267062_1162267076 25 Left 1162267062 19:9584422-9584444 CCCCGCTATCTCCGGGATCCCCA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267068_1162267076 7 Left 1162267068 19:9584440-9584462 CCCCAAGCAGGCGGAACTCACCA 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267064_1162267076 23 Left 1162267064 19:9584424-9584446 CCGCTATCTCCGGGATCCCCAAG 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267070_1162267076 5 Left 1162267070 19:9584442-9584464 CCAAGCAGGCGGAACTCACCACA 0: 1
1: 0
2: 3
3: 15
4: 109
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267067_1162267076 14 Left 1162267067 19:9584433-9584455 CCGGGATCCCCAAGCAGGCGGAA 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267059_1162267076 30 Left 1162267059 19:9584417-9584439 CCGCCCCCCGCTATCTCCGGGAT 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45
1162267063_1162267076 24 Left 1162267063 19:9584423-9584445 CCCGCTATCTCCGGGATCCCCAA 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG 0: 1
1: 1
2: 1
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162267076 Original CRISPR GGTGGACTCCACCACGATAA AGG Exonic
915314879 1:155022870-155022892 GGTGGACAGCACCCTGATAAAGG - Intronic
916485021 1:165250960-165250982 GGTGCACTCCACCAAGTTAGAGG + Intronic
917460922 1:175228331-175228353 ATTGGACTCCACCACGGAAAGGG - Intergenic
1075511053 10:123073377-123073399 GGTGGACTCCACGAAGAGCAAGG + Intergenic
1085648749 11:78247311-78247333 GGTGGCTTCCACCACCATAGTGG + Intronic
1086094523 11:83037103-83037125 GGTGGCCTGGACCAAGATAATGG + Intronic
1088558990 11:111093252-111093274 GCTTGTGTCCACCACGATAAAGG + Intergenic
1092762612 12:11823277-11823299 GGAGGTCTCCACCACGATCTAGG + Intronic
1094387069 12:29906793-29906815 GATGTACTCCACCAAAATAAGGG + Intergenic
1117660931 14:58003790-58003812 TGTGGACTCCACCATGGAAAAGG - Exonic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1121948177 14:98143310-98143332 TGTGGAATCCACCACGGTAAGGG + Intergenic
1122626573 14:103088134-103088156 GCTGGGCTCCACCACGATTGAGG - Intergenic
1131337988 15:91568771-91568793 GTTGGACTCAACTACGATGAAGG - Intergenic
1131695617 15:94874774-94874796 TGTTGACTCCACAAAGATAAGGG - Intergenic
1132749073 16:1449041-1449063 GGTGGCCTCCATCATGATGACGG + Exonic
1139668547 16:68475359-68475381 GGTGGACTCCCCCAAGATCCAGG + Intergenic
1140715552 16:77722664-77722686 GGTGGCCTCCGCTACGATCAAGG - Intronic
1142560267 17:805335-805357 GGTGGGCTCCACCACGGTCGGGG - Intronic
1146373376 17:32279269-32279291 GGTGAACAGCAACACGATAAGGG - Intronic
1162267076 19:9584470-9584492 GGTGGACTCCACCACGATAAAGG + Exonic
1162271675 19:9621171-9621193 GGCAGACTCCACCACCATAAAGG + Exonic
1162278204 19:9675023-9675045 GGTGGACTCCACCACAATAAAGG + Exonic
1162281355 19:9700397-9700419 GGTCGACTCCACCAAGATAAAGG + Exonic
929366003 2:41157453-41157475 ATTGGCCTCCACCACCATAAGGG - Intergenic
933178886 2:79207782-79207804 GGTGGACTCCTCCATCATCAGGG - Intronic
941278180 2:163517114-163517136 TGTGGACTCCACCGAGACAAGGG - Intergenic
1176672935 21:9751331-9751353 AGTGGTCACCACCAAGATAAAGG - Intergenic
961645703 3:128391738-128391760 TGTGGACTCCACCAGCATAGCGG + Intronic
962809994 3:138951519-138951541 GTTGGCCTCCACCATGAAAAAGG - Exonic
976077143 4:81312552-81312574 GGTGGACTCAACCACTATTCTGG + Intergenic
981637562 4:146898235-146898257 GGAGGAGGCCACCACTATAAGGG - Intronic
985401755 4:189600297-189600319 AGTGGACACCACCAAGATAAAGG + Intergenic
986997088 5:13619805-13619827 GGTGGACAACAACAGGATAATGG - Intergenic
990344375 5:54857001-54857023 GATGGACTCCACAACCACAAAGG - Intergenic
992808142 5:80359157-80359179 ATTGGCCTCCACCACCATAAGGG + Intergenic
994688312 5:102984621-102984643 GATAGACTCCAACACAATAATGG + Intronic
995531507 5:113096015-113096037 GGTGGAGTCCACCAGGGTACAGG - Intronic
997893460 5:137695305-137695327 AGTGGACTCAAACAGGATAAGGG - Intronic
1004002775 6:11610692-11610714 GGTGTACTCCAACATGAAAACGG + Intergenic
1011634977 6:89363158-89363180 GGTGGTCTAAACCAAGATAATGG + Intergenic
1016263619 6:142205531-142205553 GATGTACTCCATCAAGATAAGGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1023567982 7:41542422-41542444 GTTGGACTTCACCAGGATCATGG - Intergenic
1038050957 8:23811108-23811130 GGTGGACTCCACAACATCAAAGG - Intergenic
1050902419 9:10964546-10964568 GGTGGACACCCCCGCGATATGGG + Intergenic
1052357943 9:27525270-27525292 TGTGGACTTCACCAAGACAATGG + Intronic
1062707026 9:137951425-137951447 GATGGACTCCACCAAGACAGAGG - Intronic
1194070136 X:89313366-89313388 GGAGGATTCCACCACAACAAGGG - Intergenic
1200724372 Y:6648992-6649014 GGAGGATTCCACCACAACAAGGG - Intergenic
1201431755 Y:13909752-13909774 GGTGGACTCCACCCAGTTCAAGG - Intergenic