ID: 1162269297

View in Genome Browser
Species Human (GRCh38)
Location 19:9600986-9601008
Sequence TTGGATCCTTAATATAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162269291_1162269297 21 Left 1162269291 19:9600942-9600964 CCCCTTCATTTCTTGTTAGGGCA No data
Right 1162269297 19:9600986-9601008 TTGGATCCTTAATATAGGTAGGG No data
1162269292_1162269297 20 Left 1162269292 19:9600943-9600965 CCCTTCATTTCTTGTTAGGGCAG No data
Right 1162269297 19:9600986-9601008 TTGGATCCTTAATATAGGTAGGG No data
1162269293_1162269297 19 Left 1162269293 19:9600944-9600966 CCTTCATTTCTTGTTAGGGCAGC No data
Right 1162269297 19:9600986-9601008 TTGGATCCTTAATATAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162269297 Original CRISPR TTGGATCCTTAATATAGGTA GGG Intergenic
No off target data available for this crispr