ID: 1162272872

View in Genome Browser
Species Human (GRCh38)
Location 19:9630568-9630590
Sequence CCCTATTTACAGAGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162272866_1162272872 19 Left 1162272866 19:9630526-9630548 CCCACAGGTGGCCCGAGTGTATT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173
1162272865_1162272872 26 Left 1162272865 19:9630519-9630541 CCACTAACCCACAGGTGGCCCGA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173
1162272864_1162272872 27 Left 1162272864 19:9630518-9630540 CCCACTAACCCACAGGTGGCCCG 0: 1
1: 0
2: 2
3: 13
4: 88
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173
1162272868_1162272872 8 Left 1162272868 19:9630537-9630559 CCCGAGTGTATTTAATCTGTTGC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173
1162272869_1162272872 7 Left 1162272869 19:9630538-9630560 CCGAGTGTATTTAATCTGTTGCA 0: 1
1: 0
2: 0
3: 16
4: 223
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173
1162272867_1162272872 18 Left 1162272867 19:9630527-9630549 CCACAGGTGGCCCGAGTGTATTT 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG 0: 1
1: 0
2: 3
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162272872 Original CRISPR CCCTATTTACAGAGGAAAGC AGG Intronic
902417385 1:16248664-16248686 CCTTATTTACAAGGGAAAGCTGG - Exonic
902957687 1:19937063-19937085 CCAAATTTACAGACGATAGCAGG + Intergenic
902978122 1:20104009-20104031 CCCTTTTAACAAAGGAAAGTGGG + Intergenic
906867512 1:49438657-49438679 CCCTAATTACAGAAGAGAGATGG + Intronic
910296841 1:85655586-85655608 CCCTATTCAAAGAAGAAAACTGG - Intronic
911546884 1:99227929-99227951 CAATATTTAAAGGGGAAAGCGGG + Intergenic
912040363 1:105382930-105382952 CCCTATGTACATATGTAAGCAGG + Intergenic
913402377 1:118450040-118450062 CCATATTAACAGAATAAAGCTGG + Intergenic
913439876 1:118886022-118886044 CCCTAATCACAGAGGAAATGGGG + Intronic
915952612 1:160199603-160199625 CCCTCTTTTCTGAGGAAAACTGG - Intronic
916035397 1:160918000-160918022 GGCAATTTACAGAGGAAAGAGGG + Intergenic
917470295 1:175320815-175320837 CCCTGTTTAATGAGGAAAGAAGG - Exonic
920118795 1:203639927-203639949 CCCTATTTTCAGAGGCAATGTGG + Intronic
920332352 1:205218930-205218952 CCCAAATTTCAGAGGAAAGAGGG + Intergenic
923900788 1:238324021-238324043 GCCTGTGTACAGAGGAAAGGAGG - Intergenic
924173542 1:241366097-241366119 CCATATTTAAAGAGGAAACGAGG - Intergenic
1065429426 10:25638511-25638533 CCCTATTTAGGGAACAAAGCGGG - Intergenic
1066035382 10:31476526-31476548 CCTTATCTACAAAGGAGAGCAGG + Intronic
1067094088 10:43286873-43286895 CCCATTTTACAGAGGACAGGGGG + Intergenic
1067671382 10:48325268-48325290 TCTTCTTAACAGAGGAAAGCTGG - Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1070560083 10:77559576-77559598 CCCTAGCTAGAGAGGAGAGCTGG - Intronic
1070792014 10:79195279-79195301 CCCTATTCACTCAGCAAAGCAGG + Intronic
1071939241 10:90570346-90570368 CCAGATTTACAGAGAAGAGCTGG - Intergenic
1072016538 10:91352656-91352678 CCCTATTTGCAGAGGCCAGGAGG - Intergenic
1072597747 10:96890817-96890839 CCATATTAACAGAATAAAGCGGG - Intronic
1072687735 10:97548854-97548876 ACCCATTTCCAGAGGAAAACTGG - Intronic
1072885944 10:99274044-99274066 GCCTATTAACAGTGTAAAGCAGG + Intergenic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1075503871 10:123004500-123004522 GCCTAATTACAGAGGATGGCTGG + Intronic
1076450771 10:130555570-130555592 CCCTCTTGACAGTGGAAGGCAGG - Intergenic
1077235431 11:1479907-1479929 ACCCATTTACTGAGGAAATCAGG + Intronic
1078879533 11:15434349-15434371 CTCTCCTCACAGAGGAAAGCAGG - Intergenic
1080236597 11:30075940-30075962 CCAGATTTACAGAGGAAGCCTGG + Intergenic
1081834681 11:46143853-46143875 CCCCACTTCCAGGGGAAAGCTGG + Intergenic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1083958288 11:65999251-65999273 CCCTATGTAAGGAGGAAAGAAGG + Intronic
1086137817 11:83460287-83460309 CCCTATTTAGAAAAGAAAACTGG + Intronic
1086151770 11:83619468-83619490 CCATATTTACACAGCAAAGAAGG - Intronic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1088230687 11:107670771-107670793 CTCTTTTTACAGAGCACAGCAGG + Intergenic
1088545612 11:110955892-110955914 CCCTATCTACAGAGGTTAGGAGG + Intergenic
1088950840 11:114568352-114568374 CTCTATTAATAGAAGAAAGCAGG + Intergenic
1090310066 11:125728663-125728685 CCCCTTTTAAAAAGGAAAGCAGG - Intergenic
1090341045 11:126020594-126020616 CCCTATTTACAGAACAAATCTGG - Intronic
1091692671 12:2607591-2607613 CTGTATTTACAGTGGAAAGTAGG + Intronic
1092290480 12:7157160-7157182 CCCTATTCGCAGAGGACAGAGGG - Intronic
1092672924 12:10883532-10883554 ACATATTTACAGATGAAAGAGGG - Intronic
1092676804 12:10929936-10929958 ACATATTTACAGATGAAAGAGGG + Intronic
1095862617 12:46934837-46934859 ACCTATGTACAAAGGGAAGCAGG + Intergenic
1097036304 12:56126733-56126755 CCATATTCCCAGAGGTAAGCAGG - Exonic
1097137927 12:56875009-56875031 CCCTAGTTTCAGAGGGAGGCTGG + Intergenic
1099862944 12:88242493-88242515 CTCTCTTTACAGTGGAAAGATGG - Intergenic
1101557393 12:105823076-105823098 CCCTATTTTCAGTGGAAGGAGGG + Intergenic
1103208858 12:119152147-119152169 TTCTTTTTGCAGAGGAAAGCTGG - Intronic
1105816216 13:24038702-24038724 CTCTATTTACAGAAACAAGCAGG + Intronic
1105959143 13:25313186-25313208 CCCTATTTAGAGAGCAAAGCAGG + Intronic
1109704309 13:66069751-66069773 CCCTGCTCACAGAGGAAAGCTGG + Intergenic
1110293595 13:73836262-73836284 CCCCATTAACAAAGGAAAACAGG + Intronic
1112614217 13:100986949-100986971 CCTTCCTTACAGAGGACAGCTGG + Intergenic
1118107654 14:62678517-62678539 GCCGATTTCCAGAGGAAACCTGG + Intergenic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119385440 14:74255381-74255403 TCCAATTTATAGAGGAAACCTGG - Intronic
1128125517 15:65189552-65189574 CCCAATTTATAGTGGAAAACAGG - Intergenic
1130072560 15:80660350-80660372 CTCTATTTCCAGAGGAAAGGAGG + Intergenic
1130251076 15:82300708-82300730 CCCTATTAGGAGAGGAAAACGGG - Intergenic
1130279659 15:82510555-82510577 CACCATTTGCAGAAGAAAGCAGG - Intergenic
1130829370 15:87583956-87583978 CCGTATTCACAGGGGTAAGCAGG - Intergenic
1132245806 15:100295347-100295369 CCCTATTGACAGAGCTCAGCAGG - Intronic
1132294324 15:100724433-100724455 TCCTAGTGACAGAAGAAAGCAGG + Intergenic
1133302347 16:4790350-4790372 CCGTATTCACAGAAGAAAGGTGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134019990 16:10914983-10915005 CCCTACTTAGAGACAAAAGCTGG + Intronic
1134857021 16:17528386-17528408 CTCTACCTACAGAGGAAAGGAGG - Intergenic
1137665731 16:50247896-50247918 GGCTTTTTACAGAGGAGAGCAGG + Intronic
1140242687 16:73217790-73217812 CCCTGTTTACAGAGGAGCCCAGG + Intergenic
1140318823 16:73927853-73927875 CCCTATAAACAGAGGAAATCTGG + Intergenic
1140781212 16:78298468-78298490 CCCAATTTACAGGAGAAAACCGG - Intronic
1143563075 17:7706455-7706477 GCCTCTTTTCAGAGCAAAGCTGG - Intronic
1143724424 17:8835680-8835702 CACTGTCCACAGAGGAAAGCAGG + Intronic
1145809883 17:27758306-27758328 CCCCTTTTACAGAGGGAAGGGGG - Intronic
1147241761 17:39095171-39095193 CTGTATTTTCAGAGGACAGCTGG - Intronic
1153092886 18:1368786-1368808 CCTAATTTAGAGAGCAAAGCAGG - Intergenic
1153792919 18:8596106-8596128 CCCTTTTCTCAGAGGAAAGAGGG - Intergenic
1153939212 18:9962891-9962913 CCCTGTTTACAGAGGAAGCTGGG - Intergenic
1154420998 18:14227141-14227163 CCCCATTTTCAGACTAAAGCGGG + Intergenic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1157028800 18:43879613-43879635 CCCTATTTGCAGAGGAAGAAAGG - Intergenic
1157547292 18:48555440-48555462 CCCACTTTGCAGAGGAAGGCTGG + Intronic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1161096751 19:2396535-2396557 CCCTGTGTAGAGAGGAAGGCTGG - Exonic
1162152683 19:8656901-8656923 CCAGATTTACAGAGCCAAGCTGG - Intergenic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1165134643 19:33660102-33660124 CCGTATCCACAGAGGAAGGCTGG - Intronic
925513857 2:4658017-4658039 CCCTCTATACAGGGGCAAGCAGG - Intergenic
925624686 2:5831114-5831136 CCACATTTTCAGAGGAAACCAGG + Intergenic
927412738 2:22845343-22845365 CCCAGTTTACAGAGGAGAGACGG + Intergenic
931191695 2:60007556-60007578 CCCTATTTCCAGAGTTAAACTGG - Intergenic
931749218 2:65316342-65316364 CCCTTTGGACAGAGGAATGCAGG + Intronic
934651236 2:96092366-96092388 CCCAATCTACAGAGGATGGCCGG + Intergenic
937042474 2:118833250-118833272 CCCTATTTTCAGTGGAATCCAGG - Intergenic
939164620 2:138627171-138627193 CCCTCTTTACAGAGCAAAGTGGG - Intergenic
939909142 2:147959409-147959431 ACCTATTTAAAGAGTAAAGATGG + Intronic
941918841 2:170829554-170829576 CGCTGTTTTCACAGGAAAGCAGG - Exonic
942914348 2:181285128-181285150 CCAGATGTACAGAGAAAAGCTGG - Intergenic
1170810740 20:19672266-19672288 CACTATTGAGAGAGGAAATCAGG - Intronic
1171121918 20:22575875-22575897 ACCTCTTCTCAGAGGAAAGCTGG + Intergenic
1173660824 20:44732263-44732285 CAGTATTTAAAGGGGAAAGCAGG + Intergenic
1174057355 20:47807300-47807322 CTCTACTTACAGAGGAACGGAGG - Intergenic
1174619317 20:51862202-51862224 CTCTATTTACAGAGAAAACAGGG + Intergenic
1174993639 20:55541631-55541653 CCCTGTCTTCAGAGGACAGCAGG - Intergenic
1175840330 20:62022484-62022506 TCCTAGTTACAGAGGGAAGTGGG - Intronic
1177214516 21:18110928-18110950 CCCTATTTACAGAGTAACTGAGG - Intronic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1180015587 21:45080829-45080851 CCCTACCCCCAGAGGAAAGCAGG + Intronic
1180214202 21:46314506-46314528 CCCTCATCACAGAGGAAGGCTGG - Intronic
1181548956 22:23625128-23625150 CCTAATTTAAAGAGGAAAACTGG + Intronic
1183075907 22:35426601-35426623 CCCTTTCTACAGATGAAAGGAGG - Intergenic
1185173158 22:49305098-49305120 CCCTGTTTGCAGAAGACAGCAGG + Intergenic
1185379334 22:50500541-50500563 CACTATTCACATAGGAAAGGCGG + Intergenic
951867714 3:27325960-27325982 CTCTATTTTCAGAGGAAACTGGG - Intronic
953709063 3:45254660-45254682 TCCCATTCACAGAGGAAAGGAGG - Intergenic
954468506 3:50672891-50672913 CTCGATTTTCAGAGGCAAGCTGG + Intergenic
957649288 3:82978655-82978677 GCCTCTGTACAGAGGAAAGGAGG - Intergenic
957972177 3:87396632-87396654 CCCTCTTTACAGAGAATATCTGG - Intergenic
959911152 3:111765051-111765073 CCCTATTAACAAAGGCAAACTGG - Intronic
960087578 3:113607459-113607481 CCCTATTTTTAGATGAAGGCAGG + Intronic
961674578 3:128556654-128556676 CCCAATTTTTAGAGGAAAGTAGG + Intergenic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
969602258 4:8183244-8183266 CCTCGTTTACAGAGGAAGGCCGG + Intronic
970647728 4:18142040-18142062 CCCTATTGACAGAAGAAAGCAGG - Intergenic
973530022 4:51827483-51827505 CCATATTTACAAAGAAGAGCTGG - Intergenic
973789481 4:54365072-54365094 CCCTATTTATACAGGAGAGCGGG + Intergenic
977570893 4:98628422-98628444 CCCACATTACAGAGGAAAGTAGG - Intronic
979765835 4:124463212-124463234 CCCTACTTACAGAGCTCAGCAGG - Intergenic
979778938 4:124625103-124625125 TCCTATTTACTCAGGAAAGGGGG - Intergenic
982624348 4:157747048-157747070 CCCCATTAACAGAGGAGATCTGG + Intergenic
986457694 5:7936589-7936611 CCATAGGTACAGAAGAAAGCAGG + Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
988306030 5:29495294-29495316 CCATATTTACAAAGAAGAGCTGG - Intergenic
991020418 5:61974154-61974176 CACAAATGACAGAGGAAAGCAGG - Intergenic
994383229 5:99096657-99096679 TCCCTCTTACAGAGGAAAGCAGG - Intergenic
995182838 5:109245014-109245036 CCCTATTATCAGCGGAGAGCAGG + Intergenic
995903522 5:117096126-117096148 CCCGATTTAGGGAGGAAAGAGGG - Intergenic
995971818 5:117981736-117981758 TAATATTTACAGAGGAAGGCAGG + Intergenic
1000131031 5:158299814-158299836 ACTTCTTTACAGTGGAAAGCAGG + Intergenic
1001049651 5:168404156-168404178 CCCTGTTGGCAGAGGACAGCTGG + Intronic
1007729077 6:43934935-43934957 CCCTATTCTTAAAGGAAAGCAGG + Intergenic
1007922959 6:45627231-45627253 CCGTGTGTACAGAGGAAGGCTGG - Intronic
1010574828 6:77518035-77518057 TGCTATTAACAGAGAAAAGCAGG - Intergenic
1011146796 6:84227206-84227228 CCATCTCTACAGAAGAAAGCTGG - Intronic
1012548073 6:100441955-100441977 CCCTATACACAGAGAACAGCAGG + Intronic
1014653406 6:124069652-124069674 CCATATCTCCACAGGAAAGCTGG - Intronic
1015413911 6:132926863-132926885 CCTTATGTACTAAGGAAAGCTGG + Intergenic
1017104809 6:150877359-150877381 TCATTTTTAGAGAGGAAAGCTGG + Intronic
1021612400 7:22471020-22471042 CTCAATTTAAAGATGAAAGCAGG - Intronic
1022882511 7:34602732-34602754 CACTATTAACAGAAGAAAACTGG + Intergenic
1024374199 7:48619066-48619088 CCCACTTTGCAGAGGAAGGCAGG + Intronic
1028269670 7:88773272-88773294 CCCACTTTAAAGAGTAAAGCAGG + Intronic
1032577945 7:133075585-133075607 CCCTGTTCACAGAGGAGATCAGG - Intronic
1033583148 7:142754481-142754503 CACTATCTCCAGAGGAAAACAGG + Intronic
1033584694 7:142765386-142765408 CACTATCTTCAGAGGAAAACAGG + Intergenic
1033586164 7:142775954-142775976 CACTATCTTCAGAGGAAAACAGG + Intergenic
1036185216 8:6616720-6616742 CACCATTAGCAGAGGAAAGCTGG + Intronic
1038513780 8:28165692-28165714 CCCAAGTTACAGAGAAAATCTGG - Intronic
1038555165 8:28506561-28506583 CCCCATATATAGAGGAAAGTAGG + Intronic
1040484526 8:47857480-47857502 CCTTATTAAAAGAGGAAATCAGG + Intronic
1044351753 8:91174776-91174798 CACTAGTTACAAAGAAAAGCTGG - Intronic
1044703691 8:94987695-94987717 TCCTATGAAGAGAGGAAAGCTGG + Intronic
1044754210 8:95444922-95444944 CCTTCTTTAGAGAGGAAGGCAGG + Intergenic
1046108372 8:109692430-109692452 ACCTATTTTCCGAGAAAAGCAGG - Intergenic
1046228530 8:111320111-111320133 CACTATTTAAAGGGGAAGGCTGG + Intergenic
1047803249 8:128331740-128331762 CCCAATTTACAGAAGAGAGACGG - Intergenic
1048134614 8:131736517-131736539 CCCACTTTACAAAGGAAAACAGG + Intergenic
1052686314 9:31762198-31762220 CAATATTTAAAGGGGAAAGCAGG + Intergenic
1055090063 9:72354687-72354709 AACTATTTACAGATGAAAACAGG + Exonic
1057737179 9:97674036-97674058 CCCTCTTTACAGATAAAAACAGG + Intergenic
1060144755 9:121242437-121242459 CCCTTTTTCCAGAGGACAGCAGG - Intronic
1061593350 9:131613167-131613189 CCCACTGCACAGAGGAAAGCGGG + Intronic
1061641557 9:131961581-131961603 CATTATTTACAGTGGAAATCTGG - Intronic
1186563081 X:10633355-10633377 CCCTTTTAACAAAGGAAAGAGGG - Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1195974607 X:110512783-110512805 CCCATTTTACAGATGAAAACAGG - Intergenic
1197831978 X:130652730-130652752 CCTTATTGACAGAGGAAATTTGG + Intronic
1199529853 X:148833972-148833994 CCCAATTTAGACACGAAAGCTGG - Intronic
1199953846 X:152726646-152726668 CCCTATTAACAGAGGCAGGCAGG - Intergenic