ID: 1162281186

View in Genome Browser
Species Human (GRCh38)
Location 19:9699215-9699237
Sequence TAGAGGTAATGAGCCAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 838}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162281186 Original CRISPR TAGAGGTAATGAGCCAGGCG CGG (reversed) Intronic
900208777 1:1443097-1443119 TAGAAGAAATTAGCCGGGCGTGG - Intergenic
900241412 1:1619217-1619239 TAGAAAAAATGAGCCAGGTGTGG + Intronic
900424993 1:2573357-2573379 TAAAGGTCAGGAGCCAGGCAAGG + Intergenic
901009966 1:6194980-6195002 TACAGAAAATTAGCCAGGCGTGG + Intronic
901551815 1:10001022-10001044 AAGAGGCAATCAGCCAGGCACGG - Intronic
901670672 1:10854551-10854573 TATAGAAAATTAGCCAGGCGTGG + Intergenic
901834896 1:11917778-11917800 TACAGAAAATTAGCCAGGCGTGG + Intergenic
902038175 1:13472893-13472915 TAGAAGGCATGAGCCAGGCTGGG - Intergenic
902183954 1:14711214-14711236 TTGAAGGAATGAGCCAGGCATGG + Intronic
902266541 1:15270981-15271003 TACAGAAAATTAGCCAGGCGTGG + Intronic
902365761 1:15973108-15973130 TTCAGGTAATGAGCCGGACGAGG - Exonic
902402080 1:16163468-16163490 TAAAAATAATTAGCCAGGCGAGG + Intergenic
903046878 1:20571112-20571134 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
903080100 1:20803921-20803943 AAGAGGTATTGGGCCAGGTGCGG + Intergenic
903104384 1:21062743-21062765 TAGAAAAAATTAGCCAGGCGTGG - Intronic
903629468 1:24756153-24756175 TAGAAAAAATCAGCCAGGCGTGG - Intronic
903751740 1:25626512-25626534 TACAAAAAATGAGCCAGGCGTGG - Intronic
903770051 1:25758094-25758116 GAGAGGGAAAGAGCTAGGCGGGG + Intronic
903856303 1:26339455-26339477 TATAGATAAACAGCCAGGCGTGG + Intronic
903858834 1:26353312-26353334 AAGAGGAAATGAGCCTGGGGTGG - Intronic
903870563 1:26431535-26431557 TACAGAAAATGAGCCGGGCGTGG - Intergenic
904233981 1:29101744-29101766 TTGAAGCAATGAGCCAGGCGTGG + Intronic
904549615 1:31304749-31304771 TACAAATAATTAGCCAGGCGTGG - Intronic
904684269 1:32249214-32249236 GAAAGGAAATTAGCCAGGCGAGG - Intergenic
905072723 1:35241694-35241716 TAGTGAAAATGGGCCAGGCGTGG + Intergenic
905083489 1:35347159-35347181 TACAAGTAATTAGCCAGGTGTGG - Intronic
905185650 1:36194640-36194662 TAAAGTTAATGAGCTGGGCGTGG + Intergenic
905269527 1:36778116-36778138 TACAAGTAATTAGCCAGGTGTGG + Intergenic
905310519 1:37045803-37045825 AAGAAATAATGAGCCAGGCACGG - Intergenic
905413915 1:37791987-37792009 TACAAGAAATTAGCCAGGCGAGG - Intergenic
905554126 1:38868748-38868770 TACAAAAAATGAGCCAGGCGTGG + Intronic
905830575 1:41063181-41063203 TAGAGGAAACAGGCCAGGCGTGG + Intronic
906065840 1:42979624-42979646 TACAAAAAATGAGCCAGGCGTGG - Intergenic
906101011 1:43261642-43261664 TACAAGAAATTAGCCAGGCGTGG + Intronic
906127411 1:43435732-43435754 TATAGGGAAAGAGCCAGGGGAGG + Intronic
906261191 1:44392067-44392089 AAGAGGAAATGGGCCAGGCATGG + Intergenic
906295900 1:44648995-44649017 CAGAGCTAGTGAGTCAGGCGAGG + Intronic
906416906 1:45626953-45626975 TACAAAAAATGAGCCAGGCGTGG + Intergenic
906964956 1:50447279-50447301 TACAAAAAATGAGCCAGGCGTGG - Intronic
908125542 1:61026564-61026586 TAGAAAAAATTAGCCAGGCGTGG + Intronic
908202427 1:61811382-61811404 TAGAAAAAATTAGCCAGGCGTGG - Intronic
908361833 1:63375548-63375570 TAAAAGAAATGGGCCAGGCGTGG - Intronic
908559973 1:65296740-65296762 TACAAATAATTAGCCAGGCGTGG - Intronic
908992995 1:70116389-70116411 TACAGAAAATTAGCCAGGCGTGG + Intronic
910188430 1:84570874-84570896 CAGGGGTAATTAGCCAGGCTGGG + Intronic
911234173 1:95391990-95392012 TAGAGGTAATGAGGCAGTACAGG - Intergenic
912596825 1:110887217-110887239 TAGAAAAAATTAGCCAGGCGTGG - Intronic
912603753 1:110966174-110966196 TACAAAAAATGAGCCAGGCGTGG - Intergenic
913113328 1:115675343-115675365 TACAAAAAATGAGCCAGGCGTGG + Intronic
913281716 1:117191361-117191383 AAGATGTAATAGGCCAGGCGTGG + Intronic
913598219 1:120397724-120397746 TATAGGAAATTAGCCGGGCGTGG - Intergenic
914089111 1:144481592-144481614 TATAGGAAATTAGCCGGGCGTGG + Intergenic
914592609 1:149120518-149120540 TATAGGAAATTAGCCGGGCGTGG + Intergenic
914698995 1:150113603-150113625 AAGAAGAAATAAGCCAGGCGTGG + Intronic
914766706 1:150643979-150644001 TATAAGAAATTAGCCAGGCGTGG + Intergenic
914832506 1:151180724-151180746 TAGAGGGGTTGGGCCAGGCGTGG - Intronic
914935667 1:151977552-151977574 AAGTGGGAATTAGCCAGGCGTGG - Intergenic
915293437 1:154902180-154902202 AAGAGGTAATGAACCACGTGAGG + Intergenic
915370645 1:155347106-155347128 AAGAAGGAAAGAGCCAGGCGTGG + Intronic
916061885 1:161104722-161104744 TAGAGCTAAGGGGCCAGGCCAGG - Intronic
917160737 1:172054666-172054688 TACAGGGAAAGGGCCAGGCGAGG + Intronic
917527902 1:175805538-175805560 TACAGAAAATTAGCCAGGCGCGG + Intergenic
918581485 1:186136018-186136040 ATGAGTTAATTAGCCAGGCGTGG + Intronic
918737188 1:188079863-188079885 TACAAAAAATGAGCCAGGCGTGG - Intergenic
918793606 1:188862546-188862568 TACAAGAAATTAGCCAGGCGTGG + Intergenic
919188998 1:194190807-194190829 TACAAAAAATGAGCCAGGCGTGG - Intergenic
919442617 1:197655820-197655842 AAGAGTTAATGGGCCGGGCGCGG - Intronic
919447521 1:197727377-197727399 TACAAACAATGAGCCAGGCGTGG + Intronic
920383799 1:205552866-205552888 TAAAGTAAATGTGCCAGGCGTGG + Intergenic
920512721 1:206562775-206562797 TAGAAAAAATTAGCCAGGCGTGG + Intronic
920533477 1:206722202-206722224 TAGAAAAAATTAGCCAGGCGTGG + Intronic
920877804 1:209853646-209853668 TGTAGGTAATTGGCCAGGCGTGG - Exonic
920929743 1:210376153-210376175 AAGAATTATTGAGCCAGGCGTGG - Intronic
922737063 1:227992277-227992299 TAGAATTACTGAGCCAGGCAGGG + Intergenic
922848956 1:228715030-228715052 TAAAGTTAATTGGCCAGGCGCGG - Intergenic
923184202 1:231553974-231553996 TAGATTTCATGGGCCAGGCGTGG - Intronic
923325953 1:232880157-232880179 TAGAGGATTTAAGCCAGGCGCGG - Intergenic
923542018 1:234895207-234895229 TACAAGTAATTAGCCGGGCGTGG + Intergenic
923599645 1:235391197-235391219 TAGAGAGAATAAGCCAGGCGTGG + Intronic
924075289 1:240327990-240328012 TACAAAAAATGAGCCAGGCGTGG + Intronic
924539456 1:244968042-244968064 TAAAAGTACTGGGCCAGGCGCGG - Intergenic
924745772 1:246832373-246832395 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
924826617 1:247546512-247546534 TACAAAAAATGAGCCAGGCGTGG - Intronic
1063100014 10:2942104-2942126 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1063405036 10:5785664-5785686 TAAAGGTAGTGGGCCAGGTGTGG - Intronic
1064127269 10:12674099-12674121 TAAAAGTAATTAGCCAGGCATGG - Intronic
1064747021 10:18488317-18488339 TACAGAAAATTAGCCAGGCGTGG + Intronic
1065034123 10:21620844-21620866 TACAGAAAATTAGCCAGGCGTGG - Intronic
1065126828 10:22581958-22581980 TAAAAGAAATGAGCCAGGTGTGG + Intronic
1065579226 10:27154723-27154745 AAGAGGAAATCAGCCGGGCGTGG - Intronic
1065725242 10:28662502-28662524 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1065773861 10:29101663-29101685 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1066136823 10:32455605-32455627 TAAAGATACTGAGCCAGGCGCGG - Intronic
1066412391 10:35185256-35185278 TACAAGAAATTAGCCAGGCGTGG - Intronic
1066557240 10:36627708-36627730 TACAGAAAATTAGCCAGGCGCGG + Intergenic
1067106106 10:43367639-43367661 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1068128145 10:52866524-52866546 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1068336376 10:55637458-55637480 TAGAGATTTTGAGCCAGGCATGG + Intergenic
1068620550 10:59176863-59176885 TTGAGGGCATGATCCAGGCGCGG - Exonic
1069306180 10:66972864-66972886 TACAGACAATTAGCCAGGCGTGG - Intronic
1069431528 10:68339832-68339854 TAGATCTAATTAGCCAGGCGTGG - Intronic
1070011845 10:72483144-72483166 TAGAGAAAAGGGGCCAGGCGTGG - Intronic
1070029453 10:72662755-72662777 TACAAATAATTAGCCAGGCGTGG - Intergenic
1070127022 10:73630530-73630552 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1070227656 10:74527203-74527225 TACAAAAAATGAGCCAGGCGTGG + Intronic
1070910269 10:80111762-80111784 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1071252883 10:83838770-83838792 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1071935187 10:90522179-90522201 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1071956074 10:90760723-90760745 TACAGGAGATTAGCCAGGCGTGG + Intronic
1072932210 10:99675750-99675772 TACAAAAAATGAGCCAGGCGTGG - Intronic
1073144259 10:101269612-101269634 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1073308090 10:102518983-102519005 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1073359966 10:102890290-102890312 TAAAGAAAATGGGCCAGGCGCGG - Intronic
1075185757 10:120255431-120255453 TAGAGATAATAGGCCAGGCGTGG + Intergenic
1075496917 10:122929682-122929704 TAGAGTTAAGGAGCCATGCAGGG - Intergenic
1076654399 10:132013617-132013639 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1076913784 10:133407722-133407744 TATAAAAAATGAGCCAGGCGTGG - Intronic
1077620892 11:3722266-3722288 TAAAAGTAATTAGCCAGGTGTGG - Intronic
1077639992 11:3872809-3872831 TGGAGGTAAAGAGCCAGACACGG - Intronic
1077697887 11:4411752-4411774 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1078007649 11:7544616-7544638 TACAGAAAATTAGCCAGGCGTGG + Intronic
1079024581 11:16936244-16936266 TACAAAAAATGAGCCAGGCGTGG + Intronic
1079185455 11:18232034-18232056 TAAAAGAAATTAGCCAGGCGTGG - Intronic
1079844750 11:25451450-25451472 TACAAATAATTAGCCAGGCGTGG - Intergenic
1079978784 11:27126828-27126850 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1081118129 11:39231059-39231081 TACAAATAATTAGCCAGGCGTGG + Intergenic
1081482976 11:43506238-43506260 AAGAACTAATGGGCCAGGCGCGG + Intergenic
1081996462 11:47367911-47367933 TACAAAAAATGAGCCAGGCGTGG - Intronic
1082264824 11:50107306-50107328 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1082275591 11:50217853-50217875 TAGAAAAAATTAGCCAGGCGGGG - Intergenic
1082597254 11:55098391-55098413 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1083055243 11:59812994-59813016 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1083230834 11:61317660-61317682 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1083297363 11:61722293-61722315 ATGAGGAAATGGGCCAGGCGCGG + Intronic
1083539937 11:63505621-63505643 GAGAGGAAGAGAGCCAGGCGTGG + Intergenic
1083792079 11:64992355-64992377 AAGAGGAGATGAGCCAGGCGCGG - Intronic
1083890689 11:65594324-65594346 GAGAGGGCATGTGCCAGGCGGGG + Intronic
1084060796 11:66672649-66672671 TAGAAGAAATTAGCCAGGTGTGG - Intronic
1084328526 11:68415897-68415919 TACAAAAAATGAGCCAGGCGTGG + Intronic
1084382102 11:68819232-68819254 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1085009753 11:73130162-73130184 AAGAGATTATGGGCCAGGCGCGG - Intronic
1085592512 11:77777435-77777457 TATAAGAAATTAGCCAGGCGTGG + Intronic
1086918078 11:92554304-92554326 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1086947736 11:92859908-92859930 TAATGGTAATGGGCCAGGTGTGG + Intronic
1088011063 11:105001508-105001530 TAGAGAAAATTAGCCGGGCGTGG + Intronic
1088230546 11:107669677-107669699 AAGAGTTTATGGGCCAGGCGTGG + Intergenic
1088657542 11:112015038-112015060 TACAGAAAATTAGCCAGGCGTGG - Intronic
1088769507 11:113019520-113019542 TAGAGGAAAGGAGCCAGGAAAGG - Intronic
1089202120 11:116730852-116730874 TAGAGGTAATGAGTGAGAAGTGG + Intergenic
1089564984 11:119366183-119366205 CAGAGGTAATAGGCCGGGCGTGG - Intronic
1090002087 11:122970461-122970483 AAGACATGATGAGCCAGGCGTGG - Intergenic
1090793807 11:130116624-130116646 TAGTAAAAATGAGCCAGGCGTGG - Intronic
1091268178 11:134287003-134287025 TAGAAAAAATGAGCCGGGCGTGG + Intronic
1091296426 11:134477040-134477062 CAGAGATAAGGAGCCAGGGGGGG + Intergenic
1091476558 12:779690-779712 TAAGGGAAAGGAGCCAGGCGCGG - Intronic
1092130552 12:6109804-6109826 TACAGAAAATTAGCCAGGCGTGG - Intronic
1092159570 12:6308697-6308719 AAGAGTTAATAAGCCAGGAGAGG - Intergenic
1092212215 12:6653988-6654010 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1092811369 12:12274207-12274229 TACAAATAATTAGCCAGGCGTGG - Intergenic
1092840678 12:12538156-12538178 TAGATGTCTTTAGCCAGGCGTGG - Intronic
1093052501 12:14519328-14519350 AAGAGGAAGTGAGCCGGGCGTGG + Intronic
1093165717 12:15802966-15802988 TACAAGAAATTAGCCAGGCGTGG + Intronic
1093863411 12:24196173-24196195 CACAGTTAATGGGCCAGGCGTGG - Intergenic
1094573997 12:31666945-31666967 TAAAGGTTTTCAGCCAGGCGCGG - Intronic
1094648393 12:32350190-32350212 ATGATGTAGTGAGCCAGGCGTGG + Intronic
1094663549 12:32495538-32495560 TACAGAAAATTAGCCAGGCGTGG + Intronic
1094808154 12:34110141-34110163 TAGAGGGAGTGATCCAGGAGGGG - Intergenic
1095478831 12:42612863-42612885 TAAATATTATGAGCCAGGCGAGG + Intergenic
1095645477 12:44540953-44540975 TAGAGATAATTGGCCGGGCGCGG + Intronic
1095885161 12:47181137-47181159 TACAAATAATGAGCCAGGCGTGG - Intronic
1095908913 12:47405841-47405863 TTGGGGTGATGGGCCAGGCGCGG - Intergenic
1097105747 12:56623078-56623100 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1097213446 12:57390854-57390876 TACAGGAAATTAGCCAGGTGTGG + Intronic
1097950772 12:65426010-65426032 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1098381728 12:69877177-69877199 TACAAAAAATGAGCCAGGCGTGG - Intronic
1098426484 12:70370461-70370483 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1098516413 12:71381797-71381819 TACAAATAATTAGCCAGGCGTGG + Intronic
1098543674 12:71687286-71687308 TATTAGTAATGGGCCAGGCGCGG + Intronic
1100155279 12:91792096-91792118 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1100520336 12:95368744-95368766 TAAAGGAAATTAGCCAGGTGTGG + Intergenic
1101247680 12:102900203-102900225 TACAGAAAATTAGCCAGGCGTGG - Intronic
1101720521 12:107346613-107346635 TACAGAAAATTAGCCAGGCGTGG - Intronic
1101915020 12:108889398-108889420 TAATGATAATGGGCCAGGCGAGG - Intronic
1101930851 12:109012771-109012793 TATAAAAAATGAGCCAGGCGTGG + Intronic
1102505190 12:113380290-113380312 TACAAAAAATGAGCCAGGCGTGG - Intronic
1102692198 12:114770154-114770176 TACAAGTAAGGAGCCAGGCAGGG - Intergenic
1102705164 12:114874636-114874658 GAGAGGAGAGGAGCCAGGCGCGG + Intergenic
1102881056 12:116485454-116485476 AAGAGGCAATAAGCCAGGCGCGG + Intergenic
1102894688 12:116589294-116589316 TAAAAATAATGAGCCAGGCATGG + Intergenic
1103059166 12:117844988-117845010 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1103216554 12:119206092-119206114 TAATAGTAATTAGCCAGGCGTGG + Intronic
1103771659 12:123331675-123331697 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1104441387 12:128796267-128796289 TACAAATAATTAGCCAGGCGTGG + Intronic
1105205017 13:18215414-18215436 TAGAAATAATTAGCCAGGCATGG + Intergenic
1105453555 13:20520946-20520968 TATAAATAATTAGCCAGGCGTGG + Intronic
1105537972 13:21287617-21287639 AAGAGGTAATGGGCCGGGCGGGG - Intergenic
1106217142 13:27713127-27713149 TAAAGAAAATTAGCCAGGCGTGG + Intergenic
1106496487 13:30282797-30282819 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1106811711 13:33364731-33364753 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1106933753 13:34695580-34695602 CAGAGGAAATCGGCCAGGCGTGG + Intergenic
1107038977 13:35929083-35929105 TACAAGAAATTAGCCAGGCGTGG - Intronic
1107457290 13:40566532-40566554 TACAAATAATTAGCCAGGCGTGG - Intronic
1107505710 13:41031005-41031027 TAAAAGAAATGAGCCAGGCATGG + Intronic
1107891299 13:44916876-44916898 TACAAGAAATGAGCCGGGCGTGG + Intergenic
1108178776 13:47820884-47820906 TAGAGAGAATGGGCCGGGCGTGG - Intergenic
1108496314 13:51028795-51028817 TATAGGGAAAGAGCCAGGCACGG + Intergenic
1108939846 13:55939155-55939177 TACAAATAATTAGCCAGGCGTGG + Intergenic
1110183300 13:72642945-72642967 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1110861497 13:80349285-80349307 TAGGATGAATGAGCCAGGCGCGG + Intergenic
1111096856 13:83527562-83527584 TAGATGTAGTGGGCCGGGCGCGG + Intergenic
1111392321 13:87612505-87612527 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1112275900 13:98019106-98019128 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1112293736 13:98168014-98168036 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1112298634 13:98210703-98210725 TACAGAAAATTAGCCAGGCGTGG - Intronic
1112474746 13:99721197-99721219 TACAGAAAATTAGCCAGGCGTGG - Intronic
1113140850 13:107147443-107147465 TACAGGAAATTAGCCGGGCGCGG - Intergenic
1113282774 13:108808465-108808487 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1113607822 13:111622804-111622826 TACAGAAAATTAGCCAGGCGCGG + Intronic
1113724169 13:112586081-112586103 TACAAAAAATGAGCCAGGCGTGG + Intronic
1113772899 13:112922677-112922699 CAGAAGAAATTAGCCAGGCGTGG + Intronic
1114329649 14:21623636-21623658 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1115037146 14:28871677-28871699 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1115564284 14:34611932-34611954 TACAAAAAATGAGCCAGGCGTGG - Intronic
1115591208 14:34867101-34867123 TACAAATAATTAGCCAGGCGTGG + Intronic
1115716367 14:36109447-36109469 TACAAATAATTAGCCAGGCGTGG - Intergenic
1115966117 14:38890216-38890238 AAAAGATAATGAGCCAGGTGTGG - Intergenic
1116157019 14:41218588-41218610 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1116420932 14:44731655-44731677 TAGATCTAGTAAGCCAGGCGCGG + Intergenic
1116806918 14:49502915-49502937 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1116815985 14:49584265-49584287 TAGATGAACTGGGCCAGGCGAGG - Intronic
1116936375 14:50744776-50744798 TAAAAATAATTAGCCAGGCGTGG + Intronic
1117086505 14:52207181-52207203 TACAAGAAATTAGCCAGGCGAGG + Intergenic
1117774869 14:59173381-59173403 TAAAAATAATGGGCCAGGCGCGG + Intergenic
1118015406 14:61655442-61655464 TGAAGGTAATGAGACAGGAGTGG + Intronic
1118023074 14:61739039-61739061 AAGGGGTAATGGGCCAGGCATGG - Intronic
1118163562 14:63314566-63314588 TACAAAAAATGAGCCAGGCGTGG - Intronic
1118210393 14:63760845-63760867 TAGAGGTACAAGGCCAGGCGTGG - Intergenic
1118450379 14:65895651-65895673 AAGAGGGAATCAGCCAGGCATGG + Intergenic
1118755567 14:68840916-68840938 TAAAGATAATTAGCCAGGTGTGG + Intergenic
1118834998 14:69471399-69471421 AAGTGGGGATGAGCCAGGCGTGG - Intergenic
1119401617 14:74366416-74366438 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1119553495 14:75535261-75535283 TAAAAATAATTAGCCAGGCGTGG + Intronic
1119578971 14:75757131-75757153 TACAGAAAATCAGCCAGGCGTGG - Intronic
1120882180 14:89422160-89422182 TAAATGTAATGGGCCAGGTGCGG - Intronic
1120934906 14:89885520-89885542 TACAGAAAATTAGCCAGGCGTGG + Intronic
1120958959 14:90107320-90107342 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1121898488 14:97671146-97671168 CAAAAATAATGAGCCAGGCGTGG + Intergenic
1121944443 14:98105380-98105402 TAGAGGGAATGAGGTAGGAGAGG + Intergenic
1122048836 14:99041608-99041630 TGGAGGTACGGAGCCAGGCTGGG - Intergenic
1122485203 14:102074884-102074906 AAGAGAAAATTAGCCAGGCGTGG + Intergenic
1122681999 14:103472053-103472075 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1122686183 14:103508400-103508422 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1123436684 15:20259754-20259776 TAGAGAAAATGTGCCAGGCATGG - Intergenic
1123763232 15:23448611-23448633 TACAATAAATGAGCCAGGCGTGG - Intergenic
1123883695 15:24701077-24701099 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1123956469 15:25341223-25341245 TACAGAAAATTAGCCAGGCGTGG - Intronic
1124525604 15:30449160-30449182 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1124773050 15:32558524-32558546 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1124920484 15:34021529-34021551 TACAGAAAATAAGCCAGGCGCGG - Intronic
1125077280 15:35634009-35634031 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1125157334 15:36602830-36602852 TACAAAAAATGAGCCAGGCGTGG + Intronic
1125160357 15:36636260-36636282 AGAAGGTAATGGGCCAGGCGCGG + Intronic
1125495272 15:40187279-40187301 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1125627477 15:41120552-41120574 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1125635980 15:41188956-41188978 TACAAAAAATGAGCCAGGCGTGG - Intronic
1126011539 15:44307366-44307388 TACAGAAAATTAGCCAGGCGTGG - Intronic
1126587207 15:50300597-50300619 TACAGAAAATTAGCCAGGCGTGG - Intronic
1126809741 15:52389796-52389818 TAGAAAAAATTAGCCAGGCGAGG + Intronic
1127996282 15:64154745-64154767 AAGAGGAAGTCAGCCAGGCGCGG + Exonic
1128360460 15:66958080-66958102 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1128486488 15:68095684-68095706 TACAAAAAATGAGCCAGGCGTGG - Intronic
1128988075 15:72235747-72235769 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1129008057 15:72391062-72391084 TAGAAATAACCAGCCAGGCGTGG - Intergenic
1129586624 15:76874046-76874068 TACAGTAAATTAGCCAGGCGTGG - Intronic
1130288984 15:82580029-82580051 AAGAAATAATGGGCCAGGCGCGG + Intronic
1130339489 15:82987071-82987093 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1130793387 15:87180772-87180794 CAAAGGTAATGAGACATGCGGGG - Intergenic
1131177733 15:90220521-90220543 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1131417647 15:92274507-92274529 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1131702466 15:94953834-94953856 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1132180300 15:99747843-99747865 TACAAATAATTAGCCAGGCGTGG - Intergenic
1132585180 16:703072-703094 TAGAGGGAATCAGCCAGCCCCGG - Intronic
1132741745 16:1417271-1417293 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1132765089 16:1530526-1530548 GAGAGGAAAGGAGCCACGCGGGG - Intronic
1132825859 16:1905017-1905039 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1132970328 16:2684607-2684629 TACAAAAAATGAGCCAGGCGCGG + Intronic
1133057230 16:3151531-3151553 TAGTGGTGATGAGCCGGGCGCGG + Intergenic
1133077910 16:3294079-3294101 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1133140146 16:3737616-3737638 TACAAAAAATGAGCCAGGCGTGG - Intronic
1133388358 16:5388899-5388921 TAAAGGTAAGGGGCCGGGCGCGG + Intergenic
1133927991 16:10209214-10209236 TAGAATTAATAGGCCAGGCGCGG - Intergenic
1134131323 16:11652191-11652213 TAGAAAAAATTAGCCAGGCGAGG + Intergenic
1134282392 16:12829172-12829194 TACAAGTAAGGGGCCAGGCGTGG - Intergenic
1134444595 16:14321325-14321347 TAGAAAAAATTAGCCAGGCGGGG - Intergenic
1134848529 16:17461328-17461350 TATAGGCAATGAACCAGGCTAGG + Intronic
1135355325 16:21764169-21764191 TAGAAATATTGGGCCAGGCGTGG + Intergenic
1135422107 16:22312339-22312361 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1135713471 16:24739008-24739030 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1136391957 16:29971088-29971110 TACAAAAAATGAGCCAGGCGTGG + Intronic
1136591411 16:31219916-31219938 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1136847883 16:33591099-33591121 TAGAGAAAATGTGCCAGGCATGG + Intergenic
1137038353 16:35586983-35587005 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1137492990 16:48948640-48948662 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1138150999 16:54657018-54657040 TAGAGGTAAAGACACAGGCTGGG - Intergenic
1138915394 16:61457322-61457344 TACAGATAAAGAGCCAGGCTGGG - Intergenic
1139686599 16:68608849-68608871 TAGAGGGAATGAGCCAGGTGTGG + Intergenic
1139845120 16:69915420-69915442 AAGAAATAATGAGCCAGGCTTGG + Intronic
1140171151 16:72606342-72606364 TACAGAAAATCAGCCAGGCGTGG + Intergenic
1140302009 16:73767089-73767111 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1140475098 16:75235784-75235806 TAGAGGTCAGGAGCCGGGGGCGG + Exonic
1141188799 16:81808647-81808669 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1141439207 16:84018512-84018534 AAGAGGGAATGGGCCAGGCCAGG - Intronic
1142018749 16:87766673-87766695 AAGAGAAAATGAGCCGGGCGTGG - Intergenic
1203109591 16_KI270728v1_random:1439748-1439770 TAGAGAAAATGTGCCAGGCATGG + Intergenic
1142584222 17:960766-960788 TCGAGTTAATTGGCCAGGCGTGG - Intronic
1142585327 17:968779-968801 AAGACAAAATGAGCCAGGCGTGG + Intronic
1142678025 17:1527397-1527419 TACAAGAAATTAGCCAGGCGTGG - Intronic
1142732029 17:1866084-1866106 TACAGAAAATTAGCCAGGCGTGG + Intronic
1142781674 17:2186070-2186092 TACAAAAAATGAGCCAGGCGTGG + Intronic
1142797279 17:2318298-2318320 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1142860568 17:2758329-2758351 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1142998703 17:3777114-3777136 TAGAAAAAATTAGCCAGGCGAGG - Intronic
1143222998 17:5278159-5278181 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1143246886 17:5494290-5494312 TAGAGGTAAGAATCCAGGCCAGG + Intergenic
1143301793 17:5915867-5915889 TACAAATAATTAGCCAGGCGTGG - Intronic
1143305141 17:5940689-5940711 TAAAAGAAATGGGCCAGGCGTGG + Intronic
1143361714 17:6376676-6376698 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1143472151 17:7182468-7182490 TAAAGGTTATAGGCCAGGCGTGG + Intergenic
1143823980 17:9589403-9589425 AAGTGGTAATGAGCCAGGGAAGG - Intronic
1144140975 17:12347799-12347821 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1144224089 17:13127825-13127847 TACAAGTAATTAGCCAGGCGTGG + Intergenic
1144860060 17:18295921-18295943 TAGAAAAAATCAGCCAGGCGTGG - Intronic
1144912137 17:18691638-18691660 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1145019196 17:19416482-19416504 TCGGGGAAATGAGCCAGGTGGGG - Exonic
1145031900 17:19510742-19510764 TACAGAAAATTAGCCAGGCGTGG - Intronic
1145357634 17:22176209-22176231 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1145891716 17:28421167-28421189 TAAAAGAAATTAGCCAGGCGTGG - Intergenic
1146041240 17:29456887-29456909 TACAGAAAATTAGCCAGGCGTGG - Intronic
1146041948 17:29464143-29464165 AAGAGTTTATGGGCCAGGCGCGG + Intronic
1146412247 17:32596448-32596470 TACAGGTGAGGAGCCAGGGGAGG - Intronic
1146728385 17:35173965-35173987 TACAAAAAATGAGCCAGGCGTGG - Intronic
1146961226 17:36981597-36981619 AAGAAGAAATCAGCCAGGCGTGG - Intronic
1147285277 17:39397975-39397997 TAGAGGTAACTAGCCGGGTGCGG + Intronic
1147297245 17:39493838-39493860 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1147566976 17:41543020-41543042 TACAAGAAATAAGCCAGGCGTGG + Intergenic
1147718962 17:42526567-42526589 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1147732308 17:42611563-42611585 TAGAGTTAATGGGCCAGGCGTGG + Intronic
1147893169 17:43731893-43731915 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1148144338 17:45353177-45353199 TGGAGGTAATGAGTCATGCTTGG - Intergenic
1148529170 17:48372794-48372816 TAAAGGAAATTAGCCAGGTGTGG - Intronic
1148689529 17:49519344-49519366 TAAAAATATTGAGCCAGGCGTGG - Intergenic
1148929350 17:51115538-51115560 AGGAGGGAAGGAGCCAGGCGCGG + Intronic
1149265527 17:54923827-54923849 AAAAGGTAATTAGCCAGGCATGG + Intronic
1150202450 17:63371308-63371330 TACAAAAAATGAGCCAGGCGTGG + Intronic
1150910477 17:69382215-69382237 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1151329453 17:73398302-73398324 TACAGGTAATGAGACTGGCCCGG - Exonic
1151874333 17:76857998-76858020 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1151959882 17:77400299-77400321 TAGAGGATATGGGCCCGGCGTGG - Intronic
1152415003 17:80153904-80153926 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1152621624 17:81367750-81367772 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1152661050 17:81542230-81542252 TATATGAAATCAGCCAGGCGTGG + Intronic
1152664640 17:81560255-81560277 TAAAAATAATTAGCCAGGCGTGG + Intronic
1153178656 18:2407723-2407745 TACAAATAATTAGCCAGGCGTGG - Intergenic
1153289299 18:3484607-3484629 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1153292494 18:3515313-3515335 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1153325459 18:3814515-3814537 TACAAATAATTAGCCAGGCGTGG - Intronic
1153687116 18:7557481-7557503 TAAAGGAAATGAGCTGGGCGCGG - Intergenic
1153969485 18:10212640-10212662 AAGAAGTAATGGGCCAGGCGTGG + Intergenic
1153978313 18:10288468-10288490 TAGAGGTAAGGAGGAAGGGGTGG - Intergenic
1154075175 18:11193208-11193230 TAAAGGGAAGGGGCCAGGCGCGG - Intergenic
1156015546 18:32542939-32542961 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1158129338 18:54135513-54135535 CAGAGTTAATGAACCAGGCAGGG - Intergenic
1158138087 18:54227689-54227711 TATAAGAAATCAGCCAGGCGAGG + Intergenic
1158390277 18:57039353-57039375 AGCAGGTAATGAGCCAGGTGTGG + Intergenic
1158522575 18:58184011-58184033 TAGAGAAAATTAGCCAGGCGTGG + Intronic
1159044483 18:63356105-63356127 TAGTAGTAATCGGCCAGGCGCGG + Intronic
1159050879 18:63420290-63420312 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1159299664 18:66546908-66546930 AAGAGGTAATGAGACAGGACTGG + Intronic
1159589752 18:70321116-70321138 TAGACAAAATTAGCCAGGCGTGG + Intronic
1159742516 18:72190279-72190301 TAGAAGCAATTAGCCGGGCGTGG - Intergenic
1159920094 18:74220109-74220131 TTGGGGTACTGAGCCAGGCTTGG + Intergenic
1160173296 18:76572216-76572238 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1160438881 18:78873621-78873643 TAGAGGAAATTGGCCAGGAGTGG - Intergenic
1160463737 18:79058563-79058585 TACAGAAAATTAGCCAGGCGAGG + Intergenic
1160925004 19:1539999-1540021 TAAAAGAAATGGGCCAGGCGCGG - Intergenic
1161092725 19:2370481-2370503 TAAAAATAATGAGCCAGGCATGG - Intergenic
1161638775 19:5406560-5406582 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1161666300 19:5579083-5579105 TAGATATAATTAGCCAGGCACGG - Intergenic
1161734423 19:5982290-5982312 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1161878652 19:6931642-6931664 TACAAAAAATGAGCCAGGCGTGG + Intronic
1162098109 19:8322812-8322834 TAGGTGTAGTGAGCCAGACGAGG + Exonic
1162137581 19:8565185-8565207 AAAATGAAATGAGCCAGGCGTGG - Intronic
1162222005 19:9185737-9185759 AAGAGGTCATTAGCCAGGCATGG - Exonic
1162276777 19:9662050-9662072 TAGAGGTAATAGGCCAGGCATGG - Intronic
1162281186 19:9699215-9699237 TAGAGGTAATGAGCCAGGCGCGG - Intronic
1162559699 19:11409323-11409345 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1162571383 19:11475903-11475925 AAGAGTAAATGGGCCAGGCGTGG - Intronic
1162918472 19:13886672-13886694 AAGAGGCAATGAGCCAGGCTGGG + Intronic
1162978673 19:14224070-14224092 TAGAGAAAATTAGCCAGGCATGG - Intergenic
1163135837 19:15310514-15310536 TAGAAGAAATTAGCCAGGCGTGG - Intronic
1163205552 19:15799992-15800014 TAGATGCAAGGGGCCAGGCGTGG - Intergenic
1163213432 19:15858598-15858620 TAGGAATAATGTGCCAGGCGCGG + Intergenic
1163245955 19:16094377-16094399 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1163362809 19:16858569-16858591 TAAAGGTGAGGGGCCAGGCGTGG + Intronic
1163382046 19:16975550-16975572 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1163623705 19:18375801-18375823 TAAAAGTAATTAGCCAGGTGTGG - Intronic
1163628757 19:18405662-18405684 TACAGATAATTAGCCAGGCATGG - Intergenic
1163984430 19:20931761-20931783 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1164139736 19:22448340-22448362 AAAAGGGGATGAGCCAGGCGTGG - Intronic
1164274977 19:23708669-23708691 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1165086835 19:33355032-33355054 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1165413514 19:35677066-35677088 TACAGAAAATTAGCCAGGCGTGG + Intronic
1165621944 19:37255496-37255518 TAGAAAAAATGAGCCAGGAGTGG - Intergenic
1165685531 19:37816849-37816871 CAGAAGAATTGAGCCAGGCGTGG - Intronic
1165722247 19:38087860-38087882 TATAAGAAATTAGCCAGGCGCGG + Intronic
1165835867 19:38755480-38755502 TACAGAAAATTAGCCAGGCGTGG - Intronic
1165999966 19:39872008-39872030 TAGAAGGAATGGGCCAGGAGGGG + Intronic
1166036989 19:40175766-40175788 TAGAAAAAATGAGCCAGGCATGG - Intergenic
1166160411 19:40948598-40948620 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1166169290 19:41016239-41016261 TAGAAGAAATTAGCCAGGCGTGG + Intronic
1166383401 19:42367442-42367464 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1166608861 19:44170576-44170598 TACAAAAAATGAGCCAGGCGTGG + Intronic
1166665567 19:44678132-44678154 TACAGATAATTAGCCAGGTGTGG - Intronic
1166698622 19:44868755-44868777 TACAAGAAATTAGCCAGGCGTGG + Intronic
1167082776 19:47288615-47288637 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1167835245 19:52063029-52063051 TACAAATAATTAGCCAGGCGTGG - Intronic
1167909934 19:52693420-52693442 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1168086343 19:54050287-54050309 TAGAGCTTTTGGGCCAGGCGAGG - Intronic
1168182962 19:54675588-54675610 TACACAAAATGAGCCAGGCGTGG - Intronic
1168329513 19:55558953-55558975 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1168616044 19:57837873-57837895 CAAATGTATTGAGCCAGGCGTGG - Intronic
1168649251 19:58082821-58082843 TACAAAAAATGAGCCAGGCGTGG - Intronic
925430751 2:3790952-3790974 TAAAAAAAATGAGCCAGGCGTGG + Intronic
925759703 2:7172505-7172527 TAGAGGAAATAAGCCAGGGAGGG - Intergenic
925849931 2:8070316-8070338 TAAAAGAAATTAGCCAGGCGGGG - Intergenic
925928659 2:8688992-8689014 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
925988858 2:9237565-9237587 TAAAAGTAATTAGCCAGGCATGG - Intronic
926281783 2:11454640-11454662 TAGAGATACTGGGCCAGCCGCGG - Intronic
926302529 2:11614717-11614739 TACAAAAAATGAGCCAGGCGTGG - Intronic
926453571 2:13037304-13037326 AACACGTAATTAGCCAGGCGTGG + Intergenic
927807355 2:26159825-26159847 TAAAGAAAGTGAGCCAGGCGTGG + Intergenic
927907641 2:26872399-26872421 AAAAGTTAATGGGCCAGGCGCGG + Intronic
928136254 2:28689941-28689963 TAAAAATAATTAGCCAGGCGTGG + Intergenic
928531018 2:32190911-32190933 AAGCAGTAAAGAGCCAGGCGCGG - Intronic
928538516 2:32262618-32262640 TACAAGAAATTAGCCAGGCGTGG + Intronic
928550789 2:32368382-32368404 TAGAAAAAATTAGCCAGGCGTGG + Intronic
929052964 2:37853587-37853609 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
929107673 2:38380008-38380030 TAGAAGGAATGGGCCAGGCGCGG + Intergenic
929210032 2:39345764-39345786 AAGAAGAAATTAGCCAGGCGTGG + Intronic
929704309 2:44194565-44194587 TAGAAAAAATTAGCCAGGCGTGG + Intronic
930078031 2:47423389-47423411 AATGGGTAATGGGCCAGGCGTGG - Intronic
930112691 2:47692605-47692627 TACAGAAAATGAGCCAGGCATGG - Intergenic
930194998 2:48500751-48500773 CAGAAGAAATTAGCCAGGCGTGG + Intronic
930287630 2:49451690-49451712 AAGAAGTTATGGGCCAGGCGTGG + Intergenic
930532209 2:52603330-52603352 TACACGTAATTGGCCAGGCGTGG + Intergenic
931332616 2:61303750-61303772 TACAAAAAATGAGCCAGGCGTGG - Intronic
931416457 2:62086009-62086031 TTAAGAAAATGAGCCAGGCGTGG + Intronic
932120593 2:69096100-69096122 TACAAAAAATGAGCCAGGCGTGG + Intronic
932224568 2:70029481-70029503 TACAAAAAATGAGCCAGGCGTGG + Intergenic
932248354 2:70217551-70217573 TACAAAAAATGAGCCAGGCGTGG - Intronic
932731526 2:74225303-74225325 TAGTGGTTCTCAGCCAGGCGTGG + Intronic
932812888 2:74838826-74838848 TAGAAAGAATCAGCCAGGCGCGG - Intronic
932915323 2:75852094-75852116 TAGTGGAAATGAGCCAGGGAGGG + Intergenic
933687073 2:85150387-85150409 TACAAATAATTAGCCAGGCGTGG - Intronic
935896095 2:107739117-107739139 TACAGAAAATTAGCCAGGCGTGG - Intergenic
938022930 2:127920852-127920874 TAGAAAAAATGAGCCAGGCATGG - Intergenic
938396086 2:130949507-130949529 TAGAAAAAATTAGCCAGGCGTGG - Intronic
938644903 2:133320570-133320592 TACAGAAAATTAGCCAGGCGTGG + Intronic
939035629 2:137127760-137127782 TACAGAAAATTAGCCAGGCGTGG + Intronic
939265040 2:139862016-139862038 TAGAGGAAATGGGCCGGGTGCGG + Intergenic
939395342 2:141622179-141622201 TGAGAGTAATGAGCCAGGCGCGG - Intronic
939823123 2:146981319-146981341 TACAAGGAATGAGCCAGACGTGG + Intergenic
940290404 2:152072937-152072959 CAGAGGTAATTGGCCAGGCATGG - Intronic
940294227 2:152105633-152105655 TACAGAAAATGAGCCCGGCGTGG + Intergenic
940302210 2:152186934-152186956 TATAGTTAAAGGGCCAGGCGCGG - Intergenic
940785267 2:157974222-157974244 AAGAGTTAATCAGCCAGGCATGG - Intronic
941380261 2:164784024-164784046 TAGAGGTGTGGAGCCAGGCCAGG + Intronic
941752559 2:169148487-169148509 TAAAGATAATAAGCCAGGCATGG + Intronic
942271932 2:174284915-174284937 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
943821088 2:192321755-192321777 TAGAAATAATGAGCAAGGTGTGG + Intergenic
943968460 2:194369824-194369846 TATAGAAAATTAGCCAGGCGTGG - Intergenic
944139157 2:196436243-196436265 TAGAAAAAATTAGCCAGGCGTGG + Intronic
944418964 2:199508244-199508266 TATCTGGAATGAGCCAGGCGTGG - Intergenic
944506913 2:200422244-200422266 AAGAGTAAATGAGCCAGGCTTGG + Intronic
945011760 2:205471515-205471537 TACAAGAAATTAGCCAGGCGTGG - Intronic
945077022 2:206049975-206049997 TACAAAAAATGAGCCAGGCGTGG + Intronic
945282080 2:208045600-208045622 TAAAGGAAATTAGCCAGGTGTGG - Intergenic
945289147 2:208110683-208110705 TAAAAATAATTAGCCAGGCGTGG - Intergenic
945354523 2:208823546-208823568 TACAAATAATTAGCCAGGCGTGG + Intronic
946011395 2:216566759-216566781 AAGAAGAAATTAGCCAGGCGTGG + Intronic
946226843 2:218268630-218268652 TAGAGATAATTGGCCAGGTGCGG - Intronic
947499238 2:230660162-230660184 TAGAGTAAGTGGGCCAGGCGCGG - Intergenic
947630832 2:231651978-231652000 CACAGGTAATAAGCCAGGCATGG - Intergenic
949009354 2:241669661-241669683 TACAGAAAATTAGCCAGGCGTGG - Intronic
1168767654 20:392710-392732 TAGAAAAAATGAGCCAGGCATGG - Intronic
1169028968 20:2393678-2393700 TACAAAAAATGAGCCAGGCGTGG - Intronic
1169218447 20:3806760-3806782 TTGAGGGAATGAGGCTGGCGAGG - Intergenic
1169275630 20:4232066-4232088 TACAGAAAATTAGCCAGGCGTGG - Intronic
1170061131 20:12260427-12260449 TACATGCAATGGGCCAGGCGCGG - Intergenic
1172085403 20:32378225-32378247 AAGAGGTCAAGAGCCAGGCTGGG - Intronic
1172225187 20:33300740-33300762 TACAGAAAATTAGCCAGGCGTGG - Intronic
1172403316 20:34668611-34668633 TATAAGAAATTAGCCAGGCGAGG + Intronic
1172552029 20:35808726-35808748 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1172627444 20:36355943-36355965 TAGAGCTCATGACCCAGGCTAGG + Intronic
1172704760 20:36874980-36875002 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1173653253 20:44681133-44681155 TAAAGATAATAGGCCAGGCGCGG - Intergenic
1174019373 20:47517739-47517761 TAAATGTAATTGGCCAGGCGTGG - Intronic
1174282871 20:49452175-49452197 TAGAGGAGGTGAGCCAGGCAAGG - Intronic
1174298311 20:49564405-49564427 TACAGAAAATTAGCCAGGCGTGG - Intronic
1174411601 20:50340214-50340236 AAGAGGAGATGGGCCAGGCGCGG - Intergenic
1174440259 20:50545870-50545892 TAGAAACAATGAGCCAGGCATGG + Intronic
1174758422 20:53182455-53182477 TAGAGGTAACGAGGTGGGCGGGG + Intronic
1174914187 20:54637964-54637986 TACAAATAATCAGCCAGGCGTGG + Intronic
1175020256 20:55839676-55839698 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1177704838 21:24689455-24689477 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1177831688 21:26146178-26146200 TACAAAAAATGAGCCAGGCGTGG + Intronic
1178111323 21:29372911-29372933 TACAAAAAATGAGCCAGGCGAGG - Intronic
1178761447 21:35406300-35406322 TAGAGGTATTGAGGGAGGAGGGG + Intronic
1178800945 21:35795009-35795031 TACAGAAAATTAGCCAGGCGTGG - Intronic
1178863762 21:36310693-36310715 AAGATGTAATGGGCCAGGCGCGG - Intergenic
1180579145 22:16812992-16813014 TAAAGATAATGGGCCGGGCGCGG + Intronic
1180680867 22:17626149-17626171 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1180686780 22:17674448-17674470 TATAGGAAATTAGCCAGGCATGG + Intronic
1180715063 22:17866036-17866058 CAGAGGCGATGAGCCAGGCACGG + Intronic
1182905712 22:33934428-33934450 TAGGAGTAATGGGCCGGGCGCGG + Intergenic
1183800747 22:40162247-40162269 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1183838313 22:40475986-40476008 TACAAAAAATGAGCCAGGCGTGG + Intronic
1183875064 22:40773252-40773274 TACAAAAAATGAGCCAGGCGTGG + Intronic
1183906059 22:41041277-41041299 CATATGCAATGAGCCAGGCGCGG + Intergenic
1184205137 22:42997400-42997422 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1185060954 22:48606740-48606762 TCCAGGTAAGGAGCCAGGCAGGG - Intronic
1185379138 22:50499219-50499241 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
949552672 3:5124027-5124049 TAAAAGTAATTAGCCGGGCGTGG - Intronic
949671660 3:6403350-6403372 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
949675620 3:6449735-6449757 TAGTGGTTCTCAGCCAGGCGTGG + Intergenic
949993009 3:9594755-9594777 TACAAAAAATGAGCCAGGCGTGG + Intergenic
950400546 3:12766437-12766459 TACAGAAAATTAGCCAGGCGTGG + Intronic
950642403 3:14356853-14356875 TACAAATAATTAGCCAGGCGTGG + Intergenic
952094302 3:29930265-29930287 TAGAAAAAATTAGCCAGGCGTGG - Intronic
952532857 3:34279894-34279916 TAGAGGTAATGATCCGGGGGGGG - Intergenic
953258827 3:41317363-41317385 TAGATGTAATTGGCCGGGCGCGG - Intronic
953425360 3:42792516-42792538 TAGAAAAAATTAGCCAGGCGTGG + Intronic
953491963 3:43360252-43360274 TAGAAAAAATTAGCCAGGCGTGG + Intronic
953674936 3:44993559-44993581 TAGAGGTGATGAGTCAGAAGGGG + Intronic
953777945 3:45839242-45839264 TACAAGTAATGAGTCAGGCGTGG - Intronic
954172417 3:48815538-48815560 TACAAGAAATTAGCCAGGCGTGG + Intronic
954209997 3:49090930-49090952 AACAGGTAATAGGCCAGGCGCGG + Intronic
954275355 3:49538460-49538482 TACAAAAAATGAGCCAGGCGTGG - Intergenic
954340406 3:49948983-49949005 TACAAGAAATTAGCCAGGCGTGG - Intronic
954343430 3:49974525-49974547 TACAAGAAATTAGCCAGGCGTGG - Intronic
955734767 3:62026728-62026750 TACAGAAAATTAGCCAGGCGTGG + Intronic
955768945 3:62371199-62371221 AAAAGGTAACGTGCCAGGCGAGG - Exonic
955771283 3:62387143-62387165 TAGTGGTTATGAGCAAGGAGGGG - Intergenic
956071891 3:65461642-65461664 TACAGAAAATTAGCCAGGCGTGG - Intronic
956914844 3:73860265-73860287 TACAGAAAATTAGCCAGGCGTGG + Intergenic
957286503 3:78223468-78223490 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
958627417 3:96644115-96644137 TACAAGAAATTAGCCAGGCGTGG + Intergenic
958716923 3:97794930-97794952 TACAGAAAATTAGCCAGGCGTGG + Intronic
959463082 3:106650795-106650817 TAGAAAGAATTAGCCAGGCGTGG - Intergenic
960595009 3:119400278-119400300 TACAAGAAATTAGCCAGGCGTGG + Intronic
960645647 3:119879334-119879356 TAGAAAAAATTAGCCAGGCGTGG - Intronic
961233136 3:125338502-125338524 TACAAGTAATTAGCCAGGCATGG + Intronic
961418328 3:126778908-126778930 AAAATTTAATGAGCCAGGCGTGG - Intronic
961571297 3:127801009-127801031 AAGGGGTAATGAGCCAGGTGCGG + Intronic
961670972 3:128529927-128529949 TAGAAATAATTAGCCAGGCATGG - Intergenic
961699610 3:128732326-128732348 AAAAGGTAGTGGGCCAGGCGTGG - Intronic
961844493 3:129750344-129750366 TAGAAAAAATTAGCCAGGCGTGG - Intronic
962570144 3:136704671-136704693 TACAGAAAATTAGCCAGGCGTGG + Intronic
962720086 3:138165571-138165593 TAGAAAAAATTAGCCAGGCGTGG + Intronic
963203154 3:142604777-142604799 TACAAATAATTAGCCAGGCGTGG + Intronic
963879464 3:150512722-150512744 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
964311299 3:155396047-155396069 TAGAAAAAATTAGCCAGGCGTGG + Intronic
964354040 3:155832671-155832693 TACAGATAATTAGCCGGGCGTGG + Intronic
964619847 3:158710361-158710383 TAGAAAAAATTAGCCAGGCGTGG - Intronic
964722925 3:159785124-159785146 TAGAGGTTATGAACTAGACGAGG + Intronic
965362799 3:167762317-167762339 TAGGGGTAATGATCTAGGGGAGG - Intronic
965591761 3:170367262-170367284 TAGAAAAAATTAGCCAGGCGTGG - Intronic
965840245 3:172896374-172896396 TACAGAAAATTAGCCAGGCGTGG - Intronic
966213895 3:177481182-177481204 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
966350651 3:179030508-179030530 TACAGAAAATTAGCCAGGCGTGG - Intronic
966531683 3:180988711-180988733 TAGTGGAAATAGGCCAGGCGCGG + Intronic
966952170 3:184831171-184831193 TGTAGTGAATGAGCCAGGCGTGG + Intronic
967019910 3:185513748-185513770 TGAAGGAAATCAGCCAGGCGCGG + Intronic
967350274 3:188507085-188507107 TAAAGGTTATGGGCCGGGCGTGG - Intronic
967416575 3:189225085-189225107 TACAGAAAATTAGCCAGGCGTGG - Intronic
967667083 3:192185569-192185591 TATAGCTAATAGGCCAGGCGTGG + Intronic
967833333 3:193940998-193941020 CAGAAGAAATGGGCCAGGCGCGG + Intergenic
968088709 3:195886394-195886416 GAGAGGAAGTGAGCCAGCCGTGG - Intronic
968508310 4:982558-982580 TGGAAGCAATGTGCCAGGCGTGG + Intronic
969033112 4:4228929-4228951 TAAAAAAAATGAGCCAGGCGTGG - Intergenic
969563455 4:7963871-7963893 TAGAGTTAAGGAGCCACGTGTGG - Intergenic
969584615 4:8084650-8084672 TGGAGCTAAAGAGCCAGGGGCGG + Intronic
970206238 4:13658326-13658348 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
970829200 4:20315991-20316013 TAGTGATAGTGAGCCAGGCAGGG + Intronic
971609654 4:28706650-28706672 TAGATGTACTTGGCCAGGCGTGG - Intergenic
971937218 4:33167140-33167162 TAGAAATATTGGGCCAGGCGCGG - Intergenic
971947193 4:33296008-33296030 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
972311587 4:37888511-37888533 TACAGGTAGGCAGCCAGGCGGGG - Intergenic
972421361 4:38890245-38890267 TAGAAAAAATCAGCCAGGCGTGG + Intronic
972473129 4:39426094-39426116 TACAGAAAATCAGCCAGGCGTGG + Intronic
972497243 4:39645424-39645446 TCTGGGTGATGAGCCAGGCGTGG - Intergenic
973624957 4:52762405-52762427 AAGAGGGAATGAGAAAGGCGAGG - Intergenic
974068867 4:57106060-57106082 TACAGAAAATTAGCCAGGCGTGG - Intronic
974194730 4:58558079-58558101 TAGAGGTAATGGGCCGGGCATGG - Intergenic
974282727 4:59820246-59820268 TACACAAAATGAGCCAGGCGTGG - Intergenic
974415393 4:61600017-61600039 AAGAGGAAATGGGCGAGGCGTGG + Intronic
975108384 4:70595471-70595493 TAGAGGGAAAGGGCCAGGCATGG - Intronic
975353450 4:73371597-73371619 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
975400850 4:73938042-73938064 TACAAGAAATTAGCCAGGCGTGG - Intergenic
975777538 4:77804271-77804293 TACAAAAAATGAGCCAGGCGTGG + Intronic
977530931 4:98199862-98199884 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
977595499 4:98874946-98874968 TAGAAAAAATTAGCCAGGCGTGG - Intronic
978500344 4:109402597-109402619 TACAGAAAATTAGCCAGGCGTGG + Intergenic
979026939 4:115589129-115589151 AAAAGGTAATTAGCCAGGCATGG - Intergenic
979814408 4:125082318-125082340 TACAGAAAATTAGCCAGGCGTGG + Intergenic
980538637 4:134163971-134163993 TAGAAGTCCTGGGCCAGGCGCGG + Intergenic
980924010 4:139115995-139116017 TACAAGAAATTAGCCAGGCGTGG - Intronic
981161211 4:141501214-141501236 TACAGAAAATTAGCCAGGCGTGG + Intergenic
981945724 4:150341315-150341337 TACAAATAATTAGCCAGGCGTGG - Intronic
982363917 4:154554137-154554159 TACAAGTAATTAGCCAGGCGTGG - Intergenic
982569713 4:157033260-157033282 TACAAGAAATTAGCCAGGCGTGG + Intergenic
983424772 4:167569386-167569408 TAGAAAGAATTAGCCAGGCGTGG - Intergenic
983637605 4:169914200-169914222 TACAGAAAATTAGCCAGGCGTGG - Intergenic
984892660 4:184507537-184507559 AAGAGAGAATGGGCCAGGCGCGG + Intergenic
984928057 4:184824279-184824301 TACAAATAATTAGCCAGGCGTGG - Intronic
984944531 4:184960794-184960816 TTGAGAAAATGAACCAGGCGGGG - Intergenic
985000301 4:185475756-185475778 TACAAAAAATGAGCCAGGCGTGG + Intergenic
985257465 4:188084420-188084442 TAGAGGAAATTAGCCAGGCTTGG + Intergenic
986054948 5:4127527-4127549 TACAAGAAATTAGCCAGGCGTGG - Intergenic
986208875 5:5651618-5651640 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
986635932 5:9822503-9822525 TACAGAAAATTAGCCAGGCGTGG - Intergenic
986997902 5:13628276-13628298 TAGAGAAAATCAGCCAGGCACGG + Intergenic
987637914 5:20569464-20569486 TACAAATAATTAGCCAGGCGTGG + Intronic
987703424 5:21431095-21431117 TAGAAGAAATGAGCCGGGAGTGG - Intergenic
987750373 5:22031176-22031198 TAGAAAAAATTAGCCAGGCGTGG + Intronic
987801063 5:22697414-22697436 TAGAAAAAATTAGCCAGGCGTGG + Intronic
989048830 5:37298081-37298103 TACAGAAAATTAGCCAGGCGTGG + Intronic
989061974 5:37418473-37418495 TAGAAAAAATTAGCCAGGCGTGG - Intronic
989633751 5:43512936-43512958 TACAAAAAATGAGCCAGGCGTGG - Intronic
990461379 5:56034876-56034898 TACAAGAAATTAGCCAGGCGTGG - Intergenic
991969869 5:72129399-72129421 TAGAAAAAATTAGCCAGGCGTGG + Intronic
992856142 5:80863513-80863535 TAGAAAAAATTAGCCAGGCGTGG + Intronic
992930216 5:81635737-81635759 TAGAAAAAATTAGCCAGGCGTGG - Intronic
992996395 5:82338383-82338405 TTAAGATAATGAGCCAGGCATGG + Intronic
993377172 5:87162125-87162147 TACAGAAAATTAGCCAGGCGTGG - Intergenic
993390422 5:87314011-87314033 TACAAAAAATGAGCCAGGCGTGG + Intronic
993622537 5:90185868-90185890 TGGAGGAACTGGGCCAGGCGTGG - Intergenic
994316125 5:98335864-98335886 TAGTGGTAATGGGCCGGGTGCGG + Intergenic
994939426 5:106302451-106302473 TAGAGAAAATTAGTCAGGCGTGG + Intergenic
995299536 5:110561997-110562019 TAGAGACAATGAGCAAGGTGTGG + Intronic
995961318 5:117843287-117843309 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
996809962 5:127505627-127505649 TACAGAAAATTAGCCAGGCGTGG + Intergenic
996930200 5:128877026-128877048 TAGAGGTTCTAAGCCAGGAGGGG + Intronic
997290613 5:132730813-132730835 TAGAAAAAATTAGCCAGGCGTGG + Intronic
997906630 5:137823469-137823491 TAGAGAAAATTAGCCAGGTGTGG + Intergenic
997985661 5:138499541-138499563 TAGAGCTTTTGGGCCAGGCGCGG - Intergenic
998113690 5:139520857-139520879 TACAGAAAATTAGCCAGGCGTGG + Intergenic
998221341 5:140283386-140283408 TAGAAAAAATTAGCCAGGCGTGG - Intronic
998346899 5:141472383-141472405 TAGAAAAAATTAGCCAGGCGTGG + Intronic
998410807 5:141909937-141909959 TATAAGAAATTAGCCAGGCGTGG - Intergenic
999244365 5:150145743-150145765 AAAAGTTAATTAGCCAGGCGTGG + Intronic
999778882 5:154833190-154833212 TACAAAAAATGAGCCAGGCGTGG - Intronic
1000804844 5:165777103-165777125 TACAAATAATTAGCCAGGCGTGG - Intergenic
1000960675 5:167597319-167597341 TACAAAAAATGAGCCAGGCGTGG - Intronic
1000970705 5:167711235-167711257 TAGATGAAATTAGCCAGGCTAGG + Intronic
1001459100 5:171893354-171893376 TAGAGATGATGACCCAGGCTAGG - Intronic
1001623189 5:173106272-173106294 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1001628473 5:173156802-173156824 TATAAAAAATGAGCCAGGCGTGG - Intronic
1001674773 5:173502689-173502711 TACAGACAATTAGCCAGGCGTGG - Intergenic
1001764025 5:174230866-174230888 TACAGAAAATTAGCCAGGCGTGG - Intronic
1001910576 5:175514038-175514060 GAGAGGTAAGAAGCCAGGCAGGG + Intronic
1002224361 5:177708419-177708441 TACAGAAAATTAGCCAGGCGTGG + Intronic
1002625094 5:180521127-180521149 AAGATGGAATGTGCCAGGCGCGG - Intronic
1002942687 6:1732169-1732191 TACAAAAAATGAGCCAGGCGTGG + Intronic
1003155639 6:3591214-3591236 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1003249262 6:4411229-4411251 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1003323287 6:5071933-5071955 AACAGCTAATGAGCCAGGTGTGG - Intergenic
1003877915 6:10454474-10454496 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1004518186 6:16338335-16338357 TACAAAAAATGAGCCAGGCGTGG + Intronic
1004999527 6:21226866-21226888 TACAAAAAATGAGCCAGGCGTGG - Intronic
1005374941 6:25172653-25172675 TACAAGAAATTAGCCAGGCGTGG + Intergenic
1005512769 6:26526289-26526311 TAGAGCTAGTGGGCCAGGCGCGG + Intergenic
1005602430 6:27441367-27441389 TACAAATAATTAGCCAGGCGTGG - Intergenic
1005873065 6:29991408-29991430 TAGGTGAAATGAGCCAGGCAAGG + Intergenic
1006350374 6:33516636-33516658 AAGACGAAATTAGCCAGGCGTGG - Intergenic
1006869221 6:37235519-37235541 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1007134799 6:39510246-39510268 TACAAAAAATGAGCCAGGCGTGG - Intronic
1007286184 6:40749104-40749126 TAGAGTGAATGAGACAGGTGTGG - Intergenic
1007768475 6:44175619-44175641 TACAAGAAATTAGCCAGGCGTGG + Intronic
1008936094 6:56994301-56994323 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1009412387 6:63380904-63380926 TAAAAGTGATGGGCCAGGCGTGG + Intergenic
1009512421 6:64569583-64569605 TACAAGAAATTAGCCAGGCGTGG + Intronic
1009753402 6:67902160-67902182 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1010121280 6:72378681-72378703 TAATAGTAATTAGCCAGGCGTGG + Intronic
1010296557 6:74204912-74204934 TACAGTTACTTAGCCAGGCGTGG - Intergenic
1010339885 6:74737122-74737144 TAGAGGAAATTACCCAGGTGTGG - Intergenic
1011728976 6:90240976-90240998 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1011871450 6:91899211-91899233 CAGAGGCAATTAGCCAGTCGTGG + Intergenic
1012238337 6:96843713-96843735 TACAAATAATTAGCCAGGCGTGG - Intergenic
1012281453 6:97332443-97332465 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1012494828 6:99822336-99822358 CAGAAGAAATTAGCCAGGCGTGG + Intergenic
1013012693 6:106134557-106134579 AAGAGGAAATGAGGCAGGTGAGG + Intergenic
1013067593 6:106698882-106698904 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1013216789 6:108034774-108034796 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1014519190 6:122418760-122418782 AAAAGGTGATGGGCCAGGCGTGG - Intronic
1014838879 6:126193646-126193668 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1014852685 6:126361449-126361471 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1014952245 6:127569771-127569793 GAGAGGAGATGGGCCAGGCGCGG - Intronic
1015244168 6:131059268-131059290 TACAGAAAATTAGCCAGGCGTGG - Intronic
1015581560 6:134730644-134730666 TACAGAAAATAAGCCAGGCGTGG + Intergenic
1015640053 6:135321955-135321977 TACAAAAAATGAGCCAGGCGTGG - Intronic
1015707847 6:136107836-136107858 TAAAGGAAACCAGCCAGGCGTGG + Intronic
1015856445 6:137630076-137630098 TTGAGCTAATGGGCCAGGTGCGG + Intergenic
1017051343 6:150396716-150396738 TACAAAAAATGAGCCAGGCGTGG + Intronic
1017105560 6:150884428-150884450 TAGAGACAAGGGGCCAGGCGCGG - Intronic
1017483774 6:154883757-154883779 TAGAGGGAAAGAGCCACTCGAGG + Intronic
1017699745 6:157057150-157057172 TAGAAAAAATGAGCCAGGCATGG - Intronic
1017939485 6:159038542-159038564 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1018267282 6:162038998-162039020 TACAAAAAATGAGCCAGGCGTGG + Intronic
1018342632 6:162867845-162867867 TAGAGGGAAAGAACCAGGCCTGG + Intronic
1018398435 6:163399399-163399421 TAGAGGCACTTGGCCAGGCGTGG + Intergenic
1018447250 6:163869221-163869243 TACAGAAAATCAGCCAGGCGTGG - Intergenic
1019730322 7:2626218-2626240 AATACGTAATTAGCCAGGCGTGG - Intergenic
1019745481 7:2698103-2698125 TGGAGTTAGTGGGCCAGGCGTGG + Intronic
1019861101 7:3658906-3658928 TAGTGGTGATGGGCCAGGCATGG - Intronic
1019879878 7:3849262-3849284 AAGAGTGAATGAGCCAGGAGTGG - Intronic
1020062656 7:5164182-5164204 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1020169737 7:5835838-5835860 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1020254029 7:6491790-6491812 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1021990450 7:26136546-26136568 TACAAATAATTAGCCAGGCGTGG - Intergenic
1022315159 7:29238878-29238900 TGGAGAAAATGAGCAAGGCGGGG + Intronic
1022378531 7:29838072-29838094 TAGAGAAAATTAGCCGGGCGTGG - Intronic
1024267358 7:47617001-47617023 TGAAGATAATTAGCCAGGCGTGG + Intergenic
1024747409 7:52424534-52424556 TACAAATAATTAGCCAGGCGTGG - Intergenic
1024922807 7:54577827-54577849 AAGAAGAGATGAGCCAGGCGTGG + Intergenic
1025059180 7:55789546-55789568 TAGAAAAAATCAGCCAGGCGTGG + Intergenic
1025276578 7:57586881-57586903 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1025607806 7:63052027-63052049 TACACATAATTAGCCAGGCGTGG - Intergenic
1025729201 7:64095292-64095314 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1025909996 7:65820576-65820598 TAGAGGGAGTGAAGCAGGCGAGG + Intergenic
1025994109 7:66517441-66517463 GAGAGGTAATGGGCCTGGAGAGG - Intergenic
1026235430 7:68522619-68522641 AAGAGGTATGAAGCCAGGCGTGG - Intergenic
1026985722 7:74554141-74554163 GAGAGGTAATGGGCCTGGAGAGG - Intronic
1027182396 7:75950016-75950038 TACAAGAAATTAGCCAGGCGTGG - Intronic
1027487099 7:78775155-78775177 TACAAAAAATGAGCCAGGCGTGG + Intronic
1027907617 7:84206475-84206497 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1028083516 7:86606113-86606135 TAAAGAAAATCAGCCAGGCGTGG - Intergenic
1028157747 7:87450624-87450646 TACAAATAATTAGCCAGGCGTGG - Intronic
1028570995 7:92286764-92286786 TAAGGATAATAAGCCAGGCGTGG - Intronic
1028594841 7:92537358-92537380 AAGAAGAAATGGGCCAGGCGCGG - Exonic
1029416698 7:100447598-100447620 AAGAAGAAAAGAGCCAGGCGTGG + Intergenic
1029596346 7:101539479-101539501 TAAAGAAAATTAGCCAGGCGTGG - Intronic
1029599348 7:101554586-101554608 AAAAAGTAATGAGACAGGCGTGG + Intronic
1029626933 7:101725759-101725781 TAGTGGTTGGGAGCCAGGCGCGG - Intergenic
1029648846 7:101876537-101876559 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1029682767 7:102123451-102123473 TATAAAAAATGAGCCAGGCGTGG + Intronic
1029861060 7:103572690-103572712 AAAAGGAAATTAGCCAGGCGTGG - Intronic
1030001393 7:105067814-105067836 TACAGAAGATGAGCCAGGCGTGG + Intronic
1031074718 7:117201400-117201422 TAGAGGTAATGAGCCTGGTGGGG - Intronic
1031442891 7:121814692-121814714 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1032140448 7:129324808-129324830 TAGAAGTAATAAGCCAGGCCGGG - Intronic
1032717095 7:134518659-134518681 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1033345207 7:140521028-140521050 TAAAGAAAATTAGCCAGGCGTGG - Intronic
1034182920 7:149152414-149152436 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1034518163 7:151598186-151598208 TACATGAAATAAGCCAGGCGTGG + Intronic
1034551955 7:151826471-151826493 TAATGGAACTGAGCCAGGCGCGG - Intronic
1034647171 7:152658304-152658326 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1035323479 7:158049745-158049767 TACAAAAAATGAGCCAGGCGTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036152823 8:6314388-6314410 TAGAGAAAATTAGCCGGGCGTGG - Intergenic
1037711502 8:21358973-21358995 TAAAAAAAATGAGCCAGGCGTGG - Intergenic
1038202824 8:25430983-25431005 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1038778251 8:30550004-30550026 TACAAAAAATGAGCCAGGCGTGG - Intronic
1038950444 8:32408516-32408538 TAAAGGTAATGAGCCCAGCAGGG - Intronic
1039490722 8:37945431-37945453 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1039761392 8:40580166-40580188 TACAAAAAATGAGCCAGGCGTGG - Intronic
1040475321 8:47771474-47771496 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1040949069 8:52917666-52917688 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1040950628 8:52935518-52935540 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1041073910 8:54151709-54151731 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1041879252 8:62728832-62728854 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1042312455 8:67392544-67392566 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1042372496 8:68007763-68007785 TACAAAAAATGAGCCAGGCGTGG - Intronic
1042505433 8:69554821-69554843 TACAGAAAATTAGCCAGGCGTGG + Intronic
1042507765 8:69579003-69579025 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1042549463 8:69981373-69981395 AAAAGCTATTGAGCCAGGCGCGG - Intergenic
1043197599 8:77317587-77317609 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1043455786 8:80410888-80410910 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1043843618 8:85138888-85138910 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1043941476 8:86200595-86200617 AAGAGGTTGTGAGGCAGGCGAGG + Intergenic
1045162922 8:99569110-99569132 TTGTGGTAATCGGCCAGGCGTGG - Intronic
1046566443 8:115907124-115907146 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1047517253 8:125565825-125565847 AAGAGGGAATGAGCCAGGCATGG - Intergenic
1048033504 8:130654828-130654850 TACAAAAAATGAGCCAGGCGTGG + Intergenic
1048813141 8:138306736-138306758 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1049162353 8:141105474-141105496 TAAAAGAAATGAGCCAGGCATGG + Intergenic
1049836295 8:144737674-144737696 TAGAAGAAATTAGCCAGGCGTGG + Intronic
1049948621 9:622745-622767 TACAAAAAATGAGCCAGGCGTGG + Intronic
1050519469 9:6482750-6482772 TACAAGAAATTAGCCAGGCGTGG - Intronic
1050692944 9:8249074-8249096 AATAGGTATTCAGCCAGGCGTGG + Intergenic
1050757165 9:9019548-9019570 TACAAATAATTAGCCAGGCGTGG + Intronic
1052344021 9:27390241-27390263 TATATATAATTAGCCAGGCGTGG - Intronic
1052359802 9:27541490-27541512 TACAAGAAATTAGCCAGGCGTGG - Intergenic
1052507241 9:29371445-29371467 TACAGAAAATGAGCCGGGCGTGG - Intergenic
1052725527 9:32224167-32224189 TAGAAAGAATTAGCCAGGCGTGG - Intergenic
1053252536 9:36587137-36587159 TGGAAGTAATCGGCCAGGCGTGG - Intronic
1053571115 9:39308673-39308695 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1053655292 9:40213205-40213227 TACAAGAAATCAGCCAGGCGTGG - Intergenic
1053905674 9:42842440-42842462 TACAAGAAATCAGCCAGGCGTGG - Intergenic
1054092680 9:60867375-60867397 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1054114152 9:61143280-61143302 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1054126030 9:61310339-61310361 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1054367409 9:64359419-64359441 TACAAGAAATCAGCCAGGCGTGG - Intergenic
1054593603 9:67039223-67039245 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1054675035 9:67849158-67849180 TACAAGAAATCAGCCAGGCGTGG - Intergenic
1055024650 9:71706982-71707004 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1055588662 9:77786085-77786107 AAGAGTTAACAAGCCAGGCGCGG + Intronic
1055833804 9:80415445-80415467 TAGAAGTCCTGGGCCAGGCGTGG - Intergenic
1055904642 9:81278547-81278569 TACAGAAAATCAGCCAGGCGTGG + Intergenic
1056185326 9:84128930-84128952 TACAAATAATTAGCCAGGCGTGG - Intergenic
1056687994 9:88782626-88782648 TACAGAAAATTAGCCAGGCGTGG + Intergenic
1056951039 9:91040923-91040945 TAAAGGAAATTAGCCAGGCATGG - Intergenic
1056991146 9:91412551-91412573 AAGATGTAATGAGCCAGGTGTGG + Intronic
1057397330 9:94691752-94691774 TACAAAAAATGAGCCAGGCGTGG - Intergenic
1057955575 9:99404697-99404719 TGCAGGTAAGGGGCCAGGCGCGG - Intergenic
1058056308 9:100452537-100452559 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1058172433 9:101698822-101698844 TACAAGAAATTAGCCAGGCGTGG - Intronic
1058741089 9:107943246-107943268 AAGAGGTGATGAGGAAGGCGAGG + Intergenic
1059237559 9:112774998-112775020 TACAAAAAATGAGCCAGGCGTGG - Intronic
1060227788 9:121805951-121805973 TAGATGAAATAAGCCAGGCACGG + Intergenic
1060740651 9:126095702-126095724 TTGAGGTGAAGAGCCTGGCGCGG - Intergenic
1060905694 9:127302993-127303015 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1062390294 9:136331171-136331193 TTGAGGAAAGGAGCCAGGCTAGG + Intronic
1185535734 X:860324-860346 TAAAGAAAATGAGCCGGGCGAGG - Intergenic
1185582370 X:1220495-1220517 TAGATTGAATGGGCCAGGCGCGG + Intergenic
1185617371 X:1430614-1430636 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1185745448 X:2569135-2569157 TACAAATAATTAGCCAGGCGTGG - Intergenic
1185802084 X:3020431-3020453 TAGAAAAAATGAGCCGGGCGCGG + Intronic
1186288660 X:8072567-8072589 AAGAGGAAATGGGCCGGGCGCGG - Intergenic
1186429611 X:9493605-9493627 TACAGAAAATTAGCCAGGCGTGG + Intronic
1187057237 X:15752567-15752589 TACAGAAAATTAGCCAGGCGTGG + Intronic
1187144353 X:16624079-16624101 TTGAGGGGATGGGCCAGGCGCGG - Intronic
1187344968 X:18455020-18455042 TAGTGGCAATGAGCTAGGCATGG - Intronic
1187556406 X:20356490-20356512 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1188445195 X:30247786-30247808 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1188878661 X:35464993-35465015 TACAAATAATTAGCCAGGCGTGG - Intergenic
1189394415 X:40608344-40608366 TACAAGAAATAAGCCAGGCGTGG - Intergenic
1189778083 X:44487947-44487969 AAGAGGGAAGGGGCCAGGCGTGG + Intergenic
1189934661 X:46054873-46054895 AAGAGGGAATTGGCCAGGCGCGG - Intergenic
1190048820 X:47133939-47133961 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1190282128 X:48937943-48937965 TAAAGGTAGAGAGCCAGGAGAGG - Intronic
1190404934 X:50077689-50077711 TAAATGTAATTGGCCAGGCGCGG + Intronic
1190795871 X:53741345-53741367 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1190830627 X:54056230-54056252 TATAGCAAATTAGCCAGGCGTGG + Intergenic
1190833719 X:54081479-54081501 TGGTGGTAATGGGCCAGGTGTGG + Intronic
1192176690 X:68890669-68890691 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1194751910 X:97694450-97694472 AGGAGGAAATGAGCCAGGCATGG - Intergenic
1195025870 X:100876997-100877019 TAGAAAAAATTAGCCAGGCGTGG - Intergenic
1195478700 X:105318126-105318148 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1195904577 X:109830766-109830788 TAGAGGTTATTAGCCTGGCTGGG + Intergenic
1196118960 X:112027784-112027806 TTGAGGTACTCGGCCAGGCGCGG - Intronic
1196636352 X:118007251-118007273 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1196649517 X:118154442-118154464 TACAGAAAATTAGCCAGGCGTGG - Intergenic
1196799898 X:119533033-119533055 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1196821171 X:119702166-119702188 AGATGGTAATGAGCCAGGCGTGG + Intergenic
1197213653 X:123848440-123848462 TAGAAAAAATTAGCCAGGCGTGG + Intergenic
1197230750 X:124001244-124001266 TAGAAAAAATTAGCCAGGCGTGG - Intronic
1197291172 X:124660217-124660239 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1197820927 X:130540100-130540122 TAAAAGAAATGAGCCAGGCTTGG + Intergenic
1198750883 X:139935273-139935295 TAGCAGTATTGGGCCAGGCGCGG + Intronic
1200180724 X:154149047-154149069 TAGAAAAAATTAGCCAGGCGTGG + Intronic
1202133134 Y:21633182-21633204 TAGAGGTTACGAGCCAGGGTAGG + Intergenic