ID: 1162284204

View in Genome Browser
Species Human (GRCh38)
Location 19:9726110-9726132
Sequence AAGGGCCTGTTAAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162284204_1162284214 16 Left 1162284204 19:9726110-9726132 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1162284214 19:9726149-9726171 CCACACTCCATGCACTTGGAGGG No data
1162284204_1162284212 15 Left 1162284204 19:9726110-9726132 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1162284212 19:9726148-9726170 TCCACACTCCATGCACTTGGAGG No data
1162284204_1162284211 12 Left 1162284204 19:9726110-9726132 CCCCCAGAGTTTAACAGGCCCTT No data
Right 1162284211 19:9726145-9726167 TGCTCCACACTCCATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162284204 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr