ID: 1162285019

View in Genome Browser
Species Human (GRCh38)
Location 19:9731820-9731842
Sequence CACTTCAACCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162285019_1162285025 10 Left 1162285019 19:9731820-9731842 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1162285025 19:9731853-9731875 CTCAGCCCTTCTGAGTAGCTGGG 0: 1
1: 55
2: 459
3: 1311
4: 3296
1162285019_1162285028 18 Left 1162285019 19:9731820-9731842 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1162285028 19:9731861-9731883 TTCTGAGTAGCTGGGATTACAGG 0: 2076
1: 60119
2: 149618
3: 234674
4: 202027
1162285019_1162285024 9 Left 1162285019 19:9731820-9731842 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1162285024 19:9731852-9731874 CCTCAGCCCTTCTGAGTAGCTGG 0: 1
1: 66
2: 449
3: 1216
4: 1978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162285019 Original CRISPR CACTTCAACCCAGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr