ID: 1162287333

View in Genome Browser
Species Human (GRCh38)
Location 19:9748948-9748970
Sequence AACAACTGATCATCCAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162287333_1162287337 16 Left 1162287333 19:9748948-9748970 CCCTAGCTGGATGATCAGTTGTT No data
Right 1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162287333 Original CRISPR AACAACTGATCATCCAGCTA GGG (reversed) Intergenic
No off target data available for this crispr