ID: 1162287334

View in Genome Browser
Species Human (GRCh38)
Location 19:9748949-9748971
Sequence CAACAACTGATCATCCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162287334_1162287337 15 Left 1162287334 19:9748949-9748971 CCTAGCTGGATGATCAGTTGTTG No data
Right 1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162287334 Original CRISPR CAACAACTGATCATCCAGCT AGG (reversed) Intergenic
No off target data available for this crispr