ID: 1162287337

View in Genome Browser
Species Human (GRCh38)
Location 19:9748987-9749009
Sequence CTCAAACTCTACAACCGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162287334_1162287337 15 Left 1162287334 19:9748949-9748971 CCTAGCTGGATGATCAGTTGTTG No data
Right 1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG No data
1162287331_1162287337 29 Left 1162287331 19:9748935-9748957 CCATATGAAGACACCCTAGCTGG 0: 39
1: 35
2: 13
3: 8
4: 77
Right 1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG No data
1162287333_1162287337 16 Left 1162287333 19:9748948-9748970 CCCTAGCTGGATGATCAGTTGTT No data
Right 1162287337 19:9748987-9749009 CTCAAACTCTACAACCGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162287337 Original CRISPR CTCAAACTCTACAACCGCGA TGG Intergenic
No off target data available for this crispr