ID: 1162299236

View in Genome Browser
Species Human (GRCh38)
Location 19:9834998-9835020
Sequence GACGCGCGCCAAGAAGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162299232_1162299236 -4 Left 1162299232 19:9834979-9835001 CCTGGGTGGGCTCTGCGGCGACG 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1162299231_1162299236 -1 Left 1162299231 19:9834976-9834998 CCGCCTGGGTGGGCTCTGCGGCG 0: 1
1: 0
2: 1
3: 21
4: 174
Right 1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1162299225_1162299236 13 Left 1162299225 19:9834962-9834984 CCATAAGCTCTATCCCGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1162299230_1162299236 0 Left 1162299230 19:9834975-9834997 CCCGCCTGGGTGGGCTCTGCGGC 0: 1
1: 0
2: 3
3: 38
4: 300
Right 1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 32
1162299223_1162299236 18 Left 1162299223 19:9834957-9834979 CCAATCCATAAGCTCTATCCCGC 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162299236 Original CRISPR GACGCGCGCCAAGAAGGGGT CGG Intergenic
900237083 1:1598061-1598083 GACCGGCGCCACGCAGGGGTGGG + Exonic
900633827 1:3652276-3652298 GACGCGCGCCAAAAGGCGGCGGG + Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
913966778 1:143383312-143383334 GACACGAGACAGGAAGGGGTTGG + Intergenic
914061155 1:144208919-144208941 GACACGAGACAGGAAGGGGTTGG + Intergenic
914117995 1:144757450-144757472 GACACGAGACAGGAAGGGGTTGG - Intergenic
916920416 1:169460516-169460538 GGCGCACGCGGAGAAGGGGTAGG + Exonic
1076408422 10:130229348-130229370 GAAGAGCTCCAAGAGGGGGTTGG + Intergenic
1084769478 11:71333553-71333575 GAAGCCCCCCCAGAAGGGGTTGG + Intergenic
1088906653 11:114160120-114160142 AATGCTCGCCAAGAGGGGGTGGG - Intronic
1100242498 12:92723788-92723810 GAAGCCATCCAAGAAGGGGTTGG + Intronic
1103509985 12:121467433-121467455 GAGGCGAGCCAGGAAGGGGCTGG + Intronic
1123038063 14:105479284-105479306 GAGGCGCGCCTAGAGGGGATGGG + Intronic
1126150906 15:45522830-45522852 GAGGCGCGCGAGGGAGGGGTCGG + Intergenic
1129251922 15:74313954-74313976 GACACGCGGCAAGGAGGGGCTGG - Intronic
1151983671 17:77528717-77528739 GAAGCGTCCCAAGATGGGGTGGG + Intergenic
1152008534 17:77696962-77696984 GCCTTGCGCCAGGAAGGGGTTGG + Intergenic
1155972160 18:32092635-32092657 AGCGCGCGCCAGGAAGGGGGCGG - Intronic
1162021477 19:7870285-7870307 GAGGAGCGGCAAGAAGGGGTGGG + Exonic
1162299236 19:9834998-9835020 GACGCGCGCCAAGAAGGGGTCGG + Intergenic
1164824751 19:31277116-31277138 GACGCCCGCCCAGAAGAGGAAGG - Exonic
1165031460 19:33000664-33000686 GATGCGCGCCACGAAGGGTGTGG - Intronic
1202700562 1_KI270712v1_random:160807-160829 GACACGAGACAGGAAGGGGTTGG + Intergenic
927887526 2:26727803-26727825 GCACCGCGCCAAGAAGGGGCTGG + Exonic
937221972 2:120346900-120346922 GACGCGCGCCCAGAGGCGCTGGG - Intronic
948704296 2:239779502-239779524 GAAGGGCTCCAAGAAAGGGTGGG - Intronic
1183893753 22:40951285-40951307 CTCGCGCGCCAGTAAGGGGTGGG + Intergenic
1185291739 22:50030872-50030894 GACGCCCGCCACGCAGAGGTCGG + Exonic
969406093 4:6992953-6992975 GACGTGCACCAAGAAGCAGTTGG - Intronic
1002640836 5:180629947-180629969 GATGTGCACCAGGAAGGGGTTGG + Exonic
1005144206 6:22668877-22668899 GACGTGCACCAGGAAGGGGAAGG - Intergenic
1026930770 7:74221840-74221862 GGCGGGGGCCAAGAAGGGATAGG + Intronic
1036562186 8:9906723-9906745 GACGCCCGCCCAGGCGGGGTGGG - Intergenic
1039621106 8:38997343-38997365 GACCCGGGCCAAGAAGGGCTTGG - Intronic
1185761223 X:2691165-2691187 CACGCGCGCACAGAAGGGGCGGG - Exonic