ID: 1162299829

View in Genome Browser
Species Human (GRCh38)
Location 19:9838263-9838285
Sequence CTGCCACATTGGCCCACGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162299821_1162299829 28 Left 1162299821 19:9838212-9838234 CCTGTCTGCTCTCACCTAGAATG 0: 1
1: 0
2: 1
3: 9
4: 141
Right 1162299829 19:9838263-9838285 CTGCCACATTGGCCCACGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1162299822_1162299829 14 Left 1162299822 19:9838226-9838248 CCTAGAATGTTAGCTCTCTAAGG 0: 1
1: 0
2: 2
3: 33
4: 237
Right 1162299829 19:9838263-9838285 CTGCCACATTGGCCCACGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162299829 Original CRISPR CTGCCACATTGGCCCACGTC TGG Intronic
901221184 1:7584755-7584777 CTGCCAGATTGCCCCATGTGAGG - Intronic
902228991 1:15015550-15015572 CTGCCACAGAGGGCCACCTCAGG - Intronic
902413402 1:16225373-16225395 GTGCCACCTTGGCCCACCACTGG - Intergenic
902818723 1:18930602-18930624 CTGCCACAGTGGCCCTTGTTAGG - Intronic
904605241 1:31694591-31694613 CTGCCACATTGGTCCACCAAGGG - Intronic
911631917 1:100193026-100193048 CTGCCCCTTTGGCCCTCTTCAGG + Exonic
913277211 1:117150166-117150188 CTGCCTCATTGGCCTAGGTATGG + Intronic
920554402 1:206894120-206894142 CTGGCTCACTGGCCCACCTCTGG - Intergenic
920558745 1:206923395-206923417 CTGCCATCTTGGCCCATTTCAGG - Intergenic
921152547 1:212413907-212413929 CCGCCTCATTGGCCAAAGTCAGG - Exonic
1065694596 10:28368428-28368450 CTGACACTGTGGCCCAGGTCTGG - Intergenic
1065698608 10:28403209-28403231 CTGACACAGTGGCCCATGCCTGG + Intergenic
1067037544 10:42931432-42931454 CTACCACATTCACCCACCTCTGG + Intergenic
1075394559 10:122117615-122117637 CTGCCCCATTGGCTCATCTCAGG + Intronic
1077298934 11:1838412-1838434 CTGCCACAGTGGCCGAGGGCTGG - Intergenic
1077869859 11:6252595-6252617 CTGCCCCATTGGCCCAAATGTGG - Intergenic
1084383484 11:68828272-68828294 CTGCCACATCGGCCCCAGCCAGG + Intronic
1088971764 11:114780284-114780306 CTGCCTCCTTGGCCCAAGACAGG - Intergenic
1089605196 11:119637729-119637751 CTGCCACCTTTGCCCATATCTGG - Intronic
1090900783 11:131028960-131028982 CCTCCACATTGGCCCACTCCTGG + Intergenic
1091259630 11:134224280-134224302 CTGTCACCTTTGCCCTCGTCAGG + Intronic
1091642325 12:2246790-2246812 CTGGCACATTGGCCAAGGTTGGG + Intronic
1093169923 12:15848985-15849007 CTGCCACAATGGCCCAGGAAGGG + Intronic
1102999964 12:117377748-117377770 CTGCCACAGTTGCCCAAGTGAGG + Intronic
1105749455 13:23408687-23408709 CTGGCACAGTGGCTCACGCCTGG + Intronic
1114865119 14:26581711-26581733 CTGCCACATTTGCCCATCACTGG - Intronic
1116396753 14:44455740-44455762 CTCCCACATGTGCCCCCGTCAGG + Intergenic
1119435463 14:74595241-74595263 CTGCAACACTGGGCCAGGTCAGG + Intronic
1129600954 15:76997852-76997874 CAGCCAGCTTGGCCCATGTCTGG + Intronic
1129775982 15:78236794-78236816 TGGCCACTTTGGCCCACCTCAGG - Intronic
1134552884 16:15146143-15146165 CTGCCATCCTGGCCCACGTGTGG - Intergenic
1141785229 16:86195201-86195223 CTGCCTCACAGGCCCACGTGTGG + Intergenic
1147181840 17:38691374-38691396 CTCCCACAGGGGCCCACTTCTGG - Intergenic
1150124578 17:62627929-62627951 CTGCCAACTTGGCCAACTTCAGG + Intronic
1160929130 19:1561449-1561471 CTTCCATAGTGGCCCAGGTCTGG - Intronic
1161027121 19:2041883-2041905 CTGCCACAGCGGCCCACGAAGGG + Exonic
1162299829 19:9838263-9838285 CTGCCACATTGGCCCACGTCTGG + Intronic
1162496910 19:11028508-11028530 CTGCCACCTTGCCACAGGTCAGG + Intronic
1164106829 19:22114626-22114648 CAGGCACAGTGGCTCACGTCTGG - Intergenic
1164722453 19:30442221-30442243 CTTCCACATTGGAGCACGTGGGG - Intronic
1167354217 19:48993376-48993398 CAGCGCCATTGGCCCACGCCCGG + Intergenic
924991619 2:317450-317472 CAGCCACACTGGCCCATGCCGGG - Intergenic
928128316 2:28631010-28631032 CCGACACAATGGCTCACGTCTGG + Intronic
929879481 2:45823610-45823632 CTGCCACCATGGCCCACTCCTGG - Intronic
933185898 2:79278975-79278997 CTGCCATATTGTCTCACCTCAGG - Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
940849964 2:158678730-158678752 CTGCCATGTTGGCCCAGCTCTGG - Intronic
940957012 2:159738983-159739005 CTGCTACCTTGGCCCCCGTCTGG - Intronic
945198901 2:207262321-207262343 CCACCACACTGGGCCACGTCAGG - Intergenic
947296177 2:228633007-228633029 CTGTCACATTACCCCACCTCAGG + Intergenic
1176180753 20:63748272-63748294 CTGCCACATGGGCCCTCTTCAGG - Intronic
1181512117 22:23393774-23393796 CAGCCACGTTGTCCCACGCCTGG - Intergenic
1182512630 22:30829915-30829937 CTCCCACTTTGGCCCCCGTCGGG - Intronic
1183533910 22:38383584-38383606 CTGCCAGATTGGCCCAAGGCAGG - Intronic
954425271 3:50439818-50439840 CTACCTCATTGGCCCAGCTCAGG - Intronic
956170597 3:66430792-66430814 CAGCCACATATGCCCACCTCTGG + Intronic
962480310 3:135792454-135792476 CTGCCACACTGTCCTATGTCAGG - Intergenic
965117911 3:164515323-164515345 CTGCCACCTTGGCCCCCTTTGGG - Intergenic
965261300 3:166489469-166489491 CTGTCACCTTGGCCCACTCCAGG + Intergenic
967281994 3:187831891-187831913 CTGCCACACTGCCCTAAGTCAGG + Intergenic
972358327 4:38303405-38303427 CTGCCACCTTGGCCCCCTCCAGG - Intergenic
980896652 4:138866656-138866678 CTGCCACCTTGGCCCTAATCAGG + Intergenic
982070145 4:151687486-151687508 CTGCCACCTTGGCTCAGGCCTGG + Intronic
989572640 5:42959240-42959262 CTACCTCATTGGCCCATGTGGGG + Intergenic
991493536 5:67206309-67206331 CTACCACATTGGCCAATGTCAGG - Intergenic
995816432 5:116174269-116174291 CTGCCACACTGGCCTCCTTCTGG - Intronic
998956612 5:147445264-147445286 CTGGCACATGTGCCCAGGTCAGG + Intronic
1001414926 5:171538880-171538902 CTGCAACATTGGCTCTCATCTGG - Intergenic
1003344316 6:5252446-5252468 CAGCCACAATTACCCACGTCTGG + Intronic
1004131909 6:12928656-12928678 CTGCCACATAGGACAACTTCAGG - Intronic
1009595958 6:65737052-65737074 CTGCCACACTGCCTCACATCTGG + Intergenic
1018469486 6:164083134-164083156 CTGCCACTTTGCCCCTCCTCTGG - Intergenic
1018595826 6:165479390-165479412 CTGTCACAATGGCCTACCTCAGG + Intronic
1018995469 6:168706728-168706750 CTGCCGCATGGCCCCACGACTGG + Intergenic
1021343187 7:19489332-19489354 CTGCCAACTTGGCCCCCCTCTGG - Intergenic
1030045805 7:105494346-105494368 CTGGCACAGTGGCTCACGCCTGG + Intronic
1031595817 7:123648403-123648425 CTGCCCCATTTGCCCTCCTCAGG - Intergenic
1049304103 8:141890085-141890107 CTGCCACATTGGTTCACCTGGGG - Intergenic
1049491431 8:142905185-142905207 CTGCCACATTGGGGCACGGGGGG + Intronic
1054715063 9:68548587-68548609 CTCCCACATTAGCCCACATTTGG + Intergenic
1055391207 9:75823854-75823876 CTGCCAGAATGGGCTACGTCAGG + Intergenic
1057200153 9:93135364-93135386 CTGGCACGGTGGCCCACGACGGG + Intergenic
1058891508 9:109365193-109365215 CTGTCTGATTGGCCCACCTCAGG - Intergenic
1061008337 9:127941194-127941216 CTGCCACATCCTCCCACGCCAGG - Exonic
1061826235 9:133260036-133260058 CTGGCACACGGGCCCACGTCAGG - Intronic
1061894857 9:133641901-133641923 CGGCCACACTGGCTCACGGCGGG + Intronic
1062522213 9:136962775-136962797 CTCCCCCAATGGCCCACCTCAGG - Intergenic
1202593536 Y:26512431-26512453 CTACCAGATTGGCCCAAGGCAGG + Intergenic