ID: 1162301009

View in Genome Browser
Species Human (GRCh38)
Location 19:9845000-9845022
Sequence GGTAGTAAATGCAGCACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162301001_1162301009 21 Left 1162301001 19:9844956-9844978 CCATTCCTGCACTGTGAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 179
Right 1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1162301003_1162301009 16 Left 1162301003 19:9844961-9844983 CCTGCACTGTGAGGCGGGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 125
Right 1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1162300999_1162301009 24 Left 1162300999 19:9844953-9844975 CCTCCATTCCTGCACTGTGAGGC 0: 1
1: 0
2: 1
3: 26
4: 322
Right 1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162301009 Original CRISPR GGTAGTAAATGCAGCACCCA GGG Intronic
901680589 1:10910461-10910483 GGTGGTACCTGCAGCCCCCAAGG + Intergenic
911754019 1:101531780-101531802 TGTAGTAAAGCCAGGACCCATGG - Intergenic
912852314 1:113137683-113137705 TATAGTAAATGCAGGGCCCAAGG - Intergenic
914792596 1:150891632-150891654 GGTAGCAAAGGCAGCTCACAAGG - Intergenic
916512434 1:165484135-165484157 GGTAGGGCATGCAGGACCCAAGG + Intergenic
918663223 1:187115228-187115250 GATGGTAAATGCAGGCCCCACGG - Intergenic
919749943 1:201031244-201031266 GGTAGTGAATGGAGCACTCCAGG + Intergenic
921773110 1:219066778-219066800 GGTAAAATGTGCAGCACCCAAGG + Intergenic
924441551 1:244089691-244089713 GGCAATAAATCCAGCCCCCAAGG + Intergenic
1072204430 10:93190108-93190130 GGCAGTAAATGCAGGACCCTTGG - Intergenic
1073762266 10:106642681-106642703 GGATATGAATGCAGCACCCAAGG - Intronic
1074310286 10:112316562-112316584 GCTTGGAAATGCAGAACCCAGGG + Intergenic
1076794224 10:132790920-132790942 ACTTGTAAATGCAGCAGCCACGG + Intergenic
1077869467 11:6249961-6249983 GGCAGTAATTGCAGTAACCAGGG + Intergenic
1084958289 11:72703056-72703078 GGTGGTGACTGCAGCACACAGGG + Exonic
1085173151 11:74465696-74465718 GGAAGTAAATGCAGTGCTCAAGG - Intronic
1090888991 11:130906180-130906202 GGGAGCAAATGCAGCACTCTAGG + Intronic
1091578994 12:1769336-1769358 GGTGGTAAATGCAGTTCCCTGGG - Intronic
1097018295 12:56002631-56002653 GGTGATAACTCCAGCACCCAGGG + Exonic
1097102530 12:56599764-56599786 GGCAGTAAATGTGGCAGCCACGG + Exonic
1105064979 12:133188813-133188835 GGAAGTAAAAGAAGCACCCGAGG - Intronic
1110619961 13:77584400-77584422 GGGTGTAAATGCATCACCCTTGG + Intronic
1113418627 13:110152386-110152408 CGTAGTAATTGCAGGTCCCACGG + Exonic
1113784350 13:112994678-112994700 GGCAGTAAATCCAGCCCCGAGGG + Intronic
1114494296 14:23121838-23121860 GGTAGTAACTGCAGTGGCCAAGG - Intergenic
1115142965 14:30195168-30195190 TGTAAAAAATGAAGCACCCAGGG - Intergenic
1118554306 14:66997585-66997607 GGTAGTATATGCAGAACCAGAGG + Intronic
1121280302 14:92692793-92692815 GGGTGTCTATGCAGCACCCAGGG - Intergenic
1123044608 14:105505228-105505250 GGAAGTAAAGCCAGCACCCTGGG + Intergenic
1124874058 15:33574161-33574183 GGCAGCAAATGCACCACACAGGG - Intronic
1126911443 15:53421351-53421373 ATAAGTAAATGCAGCACCTATGG - Intergenic
1135143302 16:19940025-19940047 GGTAGTAGAAGCAGACCCCAGGG + Intergenic
1137540418 16:49357896-49357918 GGAAGCAAAGGCAGCGCCCATGG - Intergenic
1137860763 16:51844330-51844352 CGTAGAAAAAGCACCACCCAGGG - Intergenic
1141971807 16:87489642-87489664 GCTGGTAAATTCAGCGCCCATGG + Intronic
1152792417 17:82288653-82288675 GTCAGTATTTGCAGCACCCAAGG - Intergenic
1156875816 18:42010334-42010356 GGAAGTAAATGCAGAAGTCACGG - Intronic
1162119849 19:8457279-8457301 GGTAGTAGCAGCAGCAGCCATGG + Intronic
1162301009 19:9845000-9845022 GGTAGTAAATGCAGCACCCAGGG + Intronic
1164839828 19:31384533-31384555 AGTACTACATGCAGCAACCATGG - Intergenic
1165391921 19:35543767-35543789 GGCTGTAAAAGCAGCAGCCAAGG + Exonic
1165655168 19:37526540-37526562 GGTAGTAAGAGCAGCAGTCAGGG - Intronic
1165948685 19:39460298-39460320 GGCAGCAAATGCTGCATCCAAGG + Intronic
1168701634 19:58443402-58443424 GGTTGTTTATGCAGCAGCCAGGG - Intergenic
929996276 2:46828127-46828149 GGCAGAAACAGCAGCACCCAGGG - Intronic
930688710 2:54336690-54336712 GGTAGTAAGGGCAGCATGCAAGG + Intronic
938189186 2:129259405-129259427 GGTAGTACAGGCAGAAGCCATGG + Intergenic
938701620 2:133885032-133885054 TGTAGTCAAAGCAGCAGCCATGG + Intergenic
940181981 2:150944212-150944234 TGAAGTACATGCAGAACCCAGGG + Intergenic
942624505 2:177885279-177885301 GGTTGTGGATGCAGAACCCATGG - Intronic
947348703 2:229220541-229220563 GGTAGGAACTCCAACACCCAGGG + Intronic
1169382183 20:5117833-5117855 GCTATTAAATGCACCATCCAGGG + Intronic
1173826159 20:46048961-46048983 GGTTGGGCATGCAGCACCCAGGG - Intronic
1176363767 21:6020117-6020139 GGTAGTGGGAGCAGCACCCAAGG - Intergenic
1176882064 21:14207719-14207741 GGTAGTTCATGAAGCACACACGG + Intronic
1177058337 21:16337790-16337812 GGTAGTAAATGTTGGAGCCAAGG + Intergenic
1179759751 21:43518428-43518450 GGTAGTGGGAGCAGCACCCAAGG + Intergenic
1183773017 22:39943324-39943346 GGTAGTAAAAGAAGCTCACATGG + Intronic
953528048 3:43711801-43711823 GGGAGTCAATGCTGCTCCCAAGG - Exonic
954716605 3:52529955-52529977 GGTAGAAAAGTCAGCATCCATGG - Intronic
955503071 3:59604368-59604390 GGTAGAAAATGCAGTTGCCAAGG + Intergenic
957913787 3:86659288-86659310 GGTAGTAAATACAGCAAACAGGG + Intergenic
959459202 3:106604122-106604144 GGTAGGAATTGCTGCACACATGG + Intergenic
962080660 3:132136075-132136097 TGTAGTTAATGCCTCACCCAGGG + Intronic
962500729 3:135989155-135989177 AGTAGGAAATGCAGCTTCCAAGG + Intronic
963945872 3:151145114-151145136 GCAAGTAACTGAAGCACCCAGGG + Intronic
965559135 3:170045060-170045082 GGAAGAAAATGCAGAACTCAGGG - Intronic
966986216 3:185182668-185182690 ACTAGTAAATGCTGCACCCCGGG + Intergenic
967965321 3:194956165-194956187 GGTACAAAATGCAGAACACAAGG - Intergenic
969110416 4:4840793-4840815 GGAAGGAAATGCAGCCCCAAGGG - Intergenic
970225238 4:13850681-13850703 GGTATGAAATGCTGCACTCAAGG + Intergenic
973695001 4:53482053-53482075 GGTAGTAAATGTTGCTCCAAGGG + Intronic
975860709 4:78673673-78673695 GCTAGTAAGTGGAACACCCAGGG + Intergenic
975984560 4:80190325-80190347 GGGAGGAAATGCAGTTCCCAAGG - Intronic
977070817 4:92383712-92383734 GGTAGTAAATCCAGCATCATTGG - Intronic
977993302 4:103471225-103471247 AGTGCTAGATGCAGCACCCATGG - Intergenic
984816907 4:183847442-183847464 GGTAGTCACTTCACCACCCAGGG + Intergenic
985034436 4:185824049-185824071 GGGAGCAAATGCAGTAACCATGG - Intronic
990592507 5:57280727-57280749 GTTAGCAGATGCAGAACCCAAGG + Intergenic
991165788 5:63564566-63564588 GCTACTAAAGGCACCACCCATGG - Intergenic
998628029 5:143867670-143867692 AGTAGTATATGCAGGACCTATGG + Intergenic
998774049 5:145579037-145579059 GTTATTAAATGCATCACTCATGG - Intronic
999232962 5:150073054-150073076 GATAGTCAATGCCCCACCCAAGG - Intronic
1001943378 5:175756782-175756804 GGTAGTAAGTGCCCCACCTATGG + Intergenic
1003275245 6:4645191-4645213 GGTTGTAAATGCAGCATTCAGGG + Intergenic
1006975233 6:38094303-38094325 TGGATTAAATGCAGTACCCATGG - Intronic
1007475144 6:42114644-42114666 GTTAGGAAATTCAGCACCCATGG - Intronic
1008123888 6:47647505-47647527 AGGAGTAAACGCAGCACACAGGG - Intergenic
1008200442 6:48581617-48581639 GCTAGTAAATCCATCACCCTGGG - Intergenic
1013029650 6:106320898-106320920 GGTAGTAATTTCAGCAACTAAGG + Intronic
1013052932 6:106554702-106554724 GGTAATAAATGAAGCAGGCAGGG - Intronic
1013384938 6:109618028-109618050 TGTAGTAAATGCATCACGAATGG + Intronic
1016846633 6:148574529-148574551 CGTATTGAATGCACCACCCAGGG + Intergenic
1017324487 6:153130615-153130637 GGGAGGAAACACAGCACCCAAGG + Intronic
1020911931 7:14142005-14142027 GGTAGAAACTGCAGAATCCATGG - Intergenic
1021929142 7:25562233-25562255 TGTAGTAAAAGCTGCAGCCAAGG + Intergenic
1022073786 7:26945326-26945348 GGTAGCAAATGCAGAAACCAAGG - Intronic
1029215633 7:98947248-98947270 AGTAGAACATGCAGCACCCTTGG + Intronic
1034694916 7:153044561-153044583 GGCCGTAAATGCAACACACAGGG + Intergenic
1035155128 7:156906133-156906155 GAGGGTAAATGCAGCACCCTTGG + Intergenic
1041627774 8:60050274-60050296 GGGAGTAAATGCAGGTCCCATGG - Intergenic
1042807745 8:72790230-72790252 GGTAGTAAATGAAAGACCCCAGG + Intronic
1044391457 8:91657179-91657201 GCCAGTAAATGAAGCATCCAAGG - Intergenic
1045238315 8:100375592-100375614 GGAGTTAAATGCATCACCCAAGG - Intronic
1045831194 8:106462753-106462775 GGAAGTGAATGCATCTCCCAAGG - Intronic
1048491553 8:134898315-134898337 GGTAGCAAATGGAACACTCATGG - Intergenic
1052043766 9:23770834-23770856 GGAAGTAAAGACAGCCCCCATGG + Intronic
1052339943 9:27355058-27355080 GTTAGTAAATGCAGGGTCCAGGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1189087586 X:38042423-38042445 GGTTGCAAATGCAGAACTCAAGG + Intronic
1192737223 X:73861235-73861257 GGTGATAAATGCAGGACCCATGG + Intergenic