ID: 1162301552

View in Genome Browser
Species Human (GRCh38)
Location 19:9847819-9847841
Sequence CCTCACCCACACCCAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 368}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162301552_1162301556 11 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301556 19:9847853-9847875 TGCGCATGCAGGTATGTGTGAGG 0: 1
1: 1
2: 3
3: 49
4: 302
1162301552_1162301561 25 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301561 19:9847867-9847889 TGTGTGAGGAGAGGGGTTGTGGG 0: 1
1: 0
2: 5
3: 60
4: 508
1162301552_1162301560 24 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301560 19:9847866-9847888 ATGTGTGAGGAGAGGGGTTGTGG 0: 1
1: 0
2: 9
3: 66
4: 631
1162301552_1162301558 17 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301558 19:9847859-9847881 TGCAGGTATGTGTGAGGAGAGGG 0: 1
1: 0
2: 4
3: 33
4: 417
1162301552_1162301559 18 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301559 19:9847860-9847882 GCAGGTATGTGTGAGGAGAGGGG 0: 1
1: 0
2: 3
3: 37
4: 488
1162301552_1162301562 26 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301562 19:9847868-9847890 GTGTGAGGAGAGGGGTTGTGGGG 0: 1
1: 0
2: 3
3: 77
4: 668
1162301552_1162301555 0 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301555 19:9847842-9847864 ACAGGTGTGACTGCGCATGCAGG 0: 1
1: 0
2: 0
3: 14
4: 166
1162301552_1162301557 16 Left 1162301552 19:9847819-9847841 CCTCTTCTTGGGTGTGGGTGAGG 0: 1
1: 0
2: 4
3: 45
4: 368
Right 1162301557 19:9847858-9847880 ATGCAGGTATGTGTGAGGAGAGG 0: 1
1: 0
2: 1
3: 27
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162301552 Original CRISPR CCTCACCCACACCCAAGAAG AGG (reversed) Intronic
900171071 1:1269138-1269160 CCTCAGCCACACCCGAGACTGGG + Intronic
900171093 1:1269217-1269239 CCTCAGCCACACCCGAGACTGGG + Intronic
900171114 1:1269296-1269318 CCTCAGCCACACCCGAGACTGGG + Intronic
900358186 1:2274782-2274804 CCTCACTCCCACCCAGAAAGTGG - Intronic
902094825 1:13934512-13934534 CTTCACTGATACCCAAGAAGAGG + Intergenic
902127148 1:14224473-14224495 CATCACCCAGATCCAAGAGGTGG - Intergenic
902298581 1:15485326-15485348 CCTTCACCACACCCAAGGAGGGG + Intronic
902373060 1:16017363-16017385 CCCCACCCCCACCCCAGAAAAGG - Intronic
902705736 1:18202951-18202973 CCTCACCCAAAGCCAAGACTGGG - Intronic
904256318 1:29257270-29257292 CCCCATCCCCACCCAGGAAGGGG - Intronic
905108467 1:35577624-35577646 CCTCAGCCCCACCCCAGAAGCGG + Intronic
905662844 1:39740638-39740660 CCTCACCCACCCCCATTATGGGG - Intronic
906413291 1:45597334-45597356 CCACACCCAAACCCAACAAGTGG - Intronic
907430780 1:54410029-54410051 CCTGAACCACACCCATGCAGTGG - Intronic
908283067 1:62563102-62563124 CCTCCCTCACAACCAGGAAGGGG + Intronic
909806061 1:79875466-79875488 CCTCATACACCCCCAGGAAGGGG + Intergenic
910440508 1:87246937-87246959 CCACCCCCACACCCAACACGTGG - Intergenic
910933368 1:92464785-92464807 GCACACACACACCCAGGAAGGGG + Intergenic
914396460 1:147273936-147273958 CCACACCCACATCCATGAATAGG - Intronic
914676933 1:149913036-149913058 CCTGACCCAAGGCCAAGAAGAGG + Intronic
915474860 1:156147414-156147436 CCTTACCCCCAGCCCAGAAGTGG - Intronic
916852692 1:168719624-168719646 CCTCACTCACATCCATGAAGGGG - Intronic
917942999 1:179941986-179942008 GCCCACCCAGACTCAAGAAGAGG + Intergenic
919541115 1:198846632-198846654 CCTGACCCACACACACGATGAGG - Intergenic
919745412 1:201005544-201005566 CCTCATCCACTCCCAGGAGGAGG - Exonic
920031431 1:203039560-203039582 CCCCACCCACCTCCAAGAATAGG - Intronic
920039228 1:203085104-203085126 GCTCAGCCACACCCAGGATGGGG + Intronic
920266757 1:204729785-204729807 CATCCCCCAGACCCCAGAAGGGG - Intergenic
920566849 1:206980884-206980906 TCTCACCAACACCCAAGAAAGGG - Intergenic
921171891 1:212558223-212558245 CCCCACCCCCACCCAAGGACAGG + Intergenic
922591488 1:226780550-226780572 CCTCACCCCCATCCATGAGGCGG - Intergenic
923094964 1:230767796-230767818 CCCCAGCCACACCCAAGGAGGGG + Intronic
923239695 1:232071085-232071107 ACAAACCCACACCCAACAAGGGG - Intergenic
923555953 1:235000461-235000483 TCTCACCCCCACGCAAAAAGGGG + Intergenic
923626536 1:235618287-235618309 CCTCACACACACACAAAAAGTGG + Intronic
924318665 1:242825104-242825126 CCTCCCCCACATCCATGAATGGG + Intergenic
1063055911 10:2503978-2504000 CCTCGCACATATCCAAGAAGAGG + Intergenic
1064033921 10:11900398-11900420 CTTCACCCACCCACAAGAGGTGG + Intergenic
1064335004 10:14432191-14432213 CCTCACCCACAGCTCAGAAGGGG + Intronic
1064972242 10:21077779-21077801 CCTCCCACACACCTAGGAAGTGG + Intronic
1065320596 10:24505555-24505577 CCTCAGCCACCCACAAGGAGGGG - Intronic
1066649853 10:37643725-37643747 CCTCCCCCACTCCCCAGTAGTGG - Intergenic
1067390441 10:45858247-45858269 CCTCAGCCACTCCCAACAACTGG + Intergenic
1067476501 10:46570890-46570912 AGTCAACCACACCCAAGAGGAGG + Intergenic
1067501025 10:46805573-46805595 CCTCAGCCACTCCCAACAACTGG - Intergenic
1067593557 10:47534342-47534364 CCTCAGCCACTCCCAACAACTGG + Intronic
1067618237 10:47770891-47770913 AGTCAACCACACCCAAGAGGAGG - Intergenic
1067640666 10:48042446-48042468 CCTCAGCCACTCCCAACAACTGG + Intergenic
1067872835 10:49977820-49977842 CCTCAGCCACTCCCAACAACTGG - Intergenic
1068006984 10:51402852-51402874 CCTGGCTTACACCCAAGAAGAGG + Intronic
1069982048 10:72259682-72259704 TCCCACCCACAGCCCAGAAGGGG - Intergenic
1070137630 10:73708475-73708497 CCTCAGCCACTCCCAACAACTGG + Intergenic
1070370890 10:75780767-75780789 CCTGACACACTCCCAGGAAGGGG - Intronic
1070444184 10:76478890-76478912 CCTCCCCCACACCCCACAACAGG - Intronic
1070481302 10:76885410-76885432 CCTCCCCCACACCAAAGACAGGG - Exonic
1070826231 10:79391931-79391953 CCTCAGCCACACCCTAGACTTGG + Intronic
1073175430 10:101553550-101553572 CATCCCCCATACCCTAGAAGTGG - Exonic
1073175487 10:101554019-101554041 TCTTCCCCACACCCAAGAGGAGG + Exonic
1073561263 10:104498823-104498845 CCTCACCCCCACCCAACTACTGG - Intergenic
1074872669 10:117589236-117589258 CCTCACAAACACCCAGGAAGGGG - Intergenic
1075022283 10:118960652-118960674 CCACACCCAGCCCCATGAAGAGG - Intergenic
1075626202 10:123966020-123966042 CCACACCCACAGCCAAACAGTGG + Intergenic
1075865883 10:125719198-125719220 CCGCTCCCACACCCAGGATGGGG + Intergenic
1075964143 10:126595858-126595880 ACTCACAGACACCCAAGAAGAGG - Intronic
1076182797 10:128423540-128423562 CCTGATCCACTCCCAGGAAGAGG + Intergenic
1076186192 10:128451336-128451358 CCTCCCCCACACCCCACAGGGGG - Intergenic
1076998211 11:309465-309487 CCTTAGCCACACCAAAGAATTGG + Intronic
1077602744 11:3584851-3584873 CCTCACACACTCCCCCGAAGGGG + Intergenic
1077747793 11:4926789-4926811 CATGACTCACACCCAAGAAATGG + Intronic
1077858750 11:6156748-6156770 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1078320639 11:10331458-10331480 CCACATCCACACTCAAGGAGAGG - Intronic
1079682341 11:23313743-23313765 TCTCACCCACACTCAAGGAAAGG + Intergenic
1079762386 11:24345546-24345568 CCTCCCTTGCACCCAAGAAGAGG + Intergenic
1079920260 11:26425029-26425051 CCTCCCCCCCACCCCACAAGAGG + Intronic
1080459108 11:32438133-32438155 CGTTACCCACAACAAAGAAGAGG - Intergenic
1081049061 11:38315143-38315165 CCTCTCCCACACCCCAGCAGTGG + Intergenic
1081696105 11:45110239-45110261 CCTTATGCAGACCCAAGAAGTGG + Intronic
1081774406 11:45667436-45667458 CCCCACCCCCACCCAGGGAGTGG + Intergenic
1081945068 11:46985079-46985101 CCCCAACCCCACCCAAAAAGAGG - Intronic
1082568243 11:54707190-54707212 CCTCAGCCCCACCAAAGAAATGG - Exonic
1083425267 11:62581120-62581142 AGTCACCCAGATCCAAGAAGAGG + Exonic
1084204858 11:67585338-67585360 CTGCACCCTGACCCAAGAAGGGG - Intronic
1086445503 11:86866745-86866767 ACTCACTCACACCCAAGAGAGGG - Intronic
1086488715 11:87336906-87336928 CCTCAGCAACAGGCAAGAAGGGG - Intergenic
1087771983 11:102220779-102220801 CCTCAGTCATACCCAAGAACTGG - Intronic
1089554983 11:119311274-119311296 CCTCACCCAGCTCCAGGAAGAGG + Exonic
1089603271 11:119627680-119627702 CCTCTCCCTCGCCAAAGAAGGGG - Intronic
1090170440 11:124597865-124597887 GCCCACCCACACTCAAGAGGAGG + Intergenic
1090429358 11:126633219-126633241 CCTCACCCCCACCCCACAACAGG - Intronic
1090745497 11:129701870-129701892 ACGCAGCCACACCCATGAAGGGG - Intergenic
1090839758 11:130477623-130477645 CCTCACCCACATGCCTGAAGGGG - Intergenic
1092822066 12:12362030-12362052 CCTCACCCCCACCAAAGATTAGG + Intronic
1095899338 12:47311642-47311664 TCTCACCCACACTCAAGGGGAGG + Intergenic
1095909809 12:47414708-47414730 TCTCACCCCCACCACAGAAGAGG - Intergenic
1097729828 12:63116100-63116122 TTTCACACACACCCAAGCAGTGG + Intergenic
1098122557 12:67257075-67257097 CCCCAGCAACACCCCAGAAGAGG - Intergenic
1099526315 12:83722780-83722802 CCTCTCCTACAACCAAGAAAGGG + Intergenic
1100283448 12:93140694-93140716 CATCACCCAAGCCCAAGGAGTGG + Intergenic
1100659448 12:96681119-96681141 CCACACACACACACAAAAAGTGG + Intronic
1105611529 13:21973696-21973718 TCTCACCCACACTCAAGAGGAGG - Intergenic
1105800744 13:23901228-23901250 GCTCACCCCCACACAGGAAGCGG - Intronic
1107371536 13:39755426-39755448 CCCCACCCCCACCCCAGTAGAGG - Intronic
1110152883 13:72276217-72276239 CCTTACCAACCCCCAAGCAGGGG + Intergenic
1113291893 13:108916282-108916304 CCTCACCCGCAGCTAAGCAGAGG + Intronic
1113884796 13:113652798-113652820 TCTCACCCACACCCACCACGAGG - Intronic
1114551271 14:23534129-23534151 GCTCACCCACCTCCAAGGAGGGG - Exonic
1115343653 14:32318900-32318922 CCCCACCCCCACCCAAAGAGGGG - Intergenic
1115864031 14:37722859-37722881 ACACAGCCACACCTAAGAAGTGG + Intronic
1115948525 14:38693827-38693849 CCTCACCCATCCCCCAGCAGTGG + Intergenic
1116088190 14:40268197-40268219 CCTCACCCACACTCAAGGGGAGG + Intergenic
1116351847 14:43872471-43872493 CCTCCTCCACCCCCAAGCAGTGG - Intergenic
1116770400 14:49120728-49120750 TCCCACCCACACACAAGGAGAGG - Intergenic
1119522848 14:75298848-75298870 CCCCACGCACACACAACAAGAGG - Intergenic
1121496177 14:94392666-94392688 CCTCCCCAACACACAGGAAGTGG - Intergenic
1121804120 14:96799671-96799693 CCTCACTCACACGCACAAAGAGG - Intronic
1123901830 15:24884825-24884847 CCTGACCCAGACCCCAAAAGAGG + Intronic
1127290959 15:57570639-57570661 ACTCACTCACCCCCAAGAAAGGG - Intergenic
1127382302 15:58440601-58440623 CCCCACACACACCCCATAAGGGG - Intronic
1127386223 15:58469431-58469453 CCTCTCCCACACTGAGGAAGAGG - Intronic
1127706057 15:61548311-61548333 CCTGACCCACACCGACAAAGAGG + Intergenic
1128016891 15:64355886-64355908 CCCCACCCACGCCCAGGAAAGGG + Intronic
1128850461 15:70949961-70949983 CCTCACCCTCCCCCATCAAGTGG + Intronic
1129085034 15:73080432-73080454 CCTCTCCCAGATCCTAGAAGAGG - Intronic
1129249888 15:74303000-74303022 CCAGACCCACACCCAGGATGGGG + Intronic
1129351597 15:74958700-74958722 CCGCAGCCACTCCCAGGAAGTGG - Intronic
1130251038 15:82300484-82300506 CCACACCCACACCCGAGTGGCGG - Intergenic
1130328112 15:82897515-82897537 TCTCACCCACACTCAAGAGGAGG - Intronic
1132373552 15:101313662-101313684 CCTCACCCACTCCCAGGAGGTGG + Intronic
1132575157 16:660734-660756 CCCCACCCCCAGCCAAGATGCGG + Intronic
1134257869 16:12626498-12626520 CCCCACCCCCCCCCAAAAAGGGG + Intergenic
1135310618 16:21402341-21402363 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135310629 16:21402383-21402405 CATCACCCGAACCCAAGAGGCGG - Exonic
1135310638 16:21402428-21402450 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135310649 16:21402470-21402492 CATCACCCGAACCCAAGAGGCGG - Exonic
1135310658 16:21402515-21402537 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135363566 16:21834775-21834797 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135363577 16:21834817-21834839 CATCACCCGAACCCAAGAGGCGG - Exonic
1135363586 16:21834862-21834884 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135363597 16:21834904-21834926 CATCACCCGAACCCAAGAGGCGG - Exonic
1135363606 16:21834949-21834971 CGTCACGCAAACCCAAGAGGCGG - Exonic
1135448186 16:22536132-22536154 CGTCACGCAAACCCAAGAGGCGG + Exonic
1135448195 16:22536177-22536199 CATCACCCGAACCCAAGAGGCGG + Exonic
1135448206 16:22536219-22536241 CGTCACGCAAACCCAAGAGGCGG + Exonic
1135448215 16:22536264-22536286 CATCACCCGAACCCAAGAGGCGG + Exonic
1135448226 16:22536306-22536328 CGTCACGCAAACCCAAGAGGCGG + Exonic
1136307354 16:29381458-29381480 CATCACCCGAACCCAAGAGGCGG - Exonic
1136307363 16:29381503-29381525 CGTCACGCAAACCCAAGAGGCGG - Exonic
1136307374 16:29381545-29381567 CATCACCCGAACCCAAGAGGCGG - Exonic
1136307383 16:29381590-29381612 CGTCACGCAAACCCAAGAGGCGG - Exonic
1136320888 16:29483746-29483768 CGTCACGCAAACCCAAGAGGCGG - Intronic
1136320899 16:29483788-29483810 CATCACCCGAACCCAAGAGGCGG - Intronic
1136320908 16:29483833-29483855 CGTCACGCAAACCCAAGAGGCGG - Intronic
1136320919 16:29483875-29483897 CATCACCCGAACCCAAGAGGCGG - Intronic
1136320928 16:29483920-29483942 CGTCACGCAAACCCAAGAGGCGG - Intronic
1136435452 16:30223041-30223063 CATCACCCGAACCCAAGAGGCGG - Exonic
1136435461 16:30223086-30223108 CGTCACGCAAACCCAAGAGGCGG - Exonic
1136435472 16:30223128-30223150 CATCACCCGAACCCAAGAGGCGG - Exonic
1136435481 16:30223173-30223195 CGTCACGCAAACCCAAGAGGCGG - Exonic
1136435492 16:30223215-30223237 CATCACCCAAACCCAAGAGGCGG - Exonic
1136435501 16:30223260-30223282 CGTCACGCAAACCCAAGAGGCGG - Exonic
1138927929 16:61614527-61614549 CCTCACTCATTCCCATGAAGGGG + Intergenic
1139231803 16:65290606-65290628 CACCACACACACACAAGAAGAGG + Intergenic
1140384183 16:74519713-74519735 CCCCACCCACTCCCCAGAAGCGG + Intronic
1140574309 16:76147736-76147758 CCTAACTCACACTCAAGAGGAGG - Intergenic
1141501976 16:84450653-84450675 CCTCACTGACACCAAAGATGGGG - Intronic
1141612122 16:85187724-85187746 CCTCACCCACACACAGGGACAGG + Intergenic
1141868813 16:86770209-86770231 TCTCAACCACCCCCAAGATGTGG - Intergenic
1142256809 16:89017750-89017772 CGTCACCCACAGCCAGGAAGAGG + Intergenic
1142929234 17:3268336-3268358 TTTCACCCACACCCAAGAGAGGG - Intergenic
1143020985 17:3917098-3917120 CAGCCCCCACAGCCAAGAAGTGG - Intergenic
1144042793 17:11427837-11427859 CCTCGCCTCCACCCAAGAACAGG - Intronic
1144250257 17:13409206-13409228 CCTCACCCATCCCCACTAAGAGG + Intergenic
1146272575 17:31493978-31494000 CCTCAGCCACCCCAAAGCAGGGG - Intronic
1146545893 17:33738238-33738260 CATCAACCACATCTAAGAAGAGG - Intronic
1146936580 17:36815962-36815984 CATCACATACACCCAAGAGGTGG - Intergenic
1147925965 17:43946114-43946136 CCTGACCCAGACCCCAAAAGAGG - Intergenic
1148560202 17:48601792-48601814 CCCCACCCCCACCCAGGAACGGG + Intronic
1148798826 17:50210605-50210627 CCTCCCCCACACTCAGGGAGAGG + Intergenic
1148908555 17:50927292-50927314 CCGCACCCAGCCCCAAGATGTGG + Intergenic
1150267003 17:63838288-63838310 CCCCACCCACAGCCCAGAACTGG + Intronic
1150285181 17:63950176-63950198 CCTCACCCTCAGCCTTGAAGGGG - Intronic
1151254753 17:72867693-72867715 CCATACCCACACACAAGAAAGGG + Intronic
1151449463 17:74189267-74189289 TCTCACCCACACACAAGGGGAGG + Intergenic
1151455459 17:74223073-74223095 CCTCATCCAAACCAAAGAACTGG - Intronic
1151556727 17:74850463-74850485 CCTGCCCCACACCCAAGCATGGG + Intronic
1152635202 17:81428063-81428085 CCTCCCCTGCACCCAGGAAGAGG - Intronic
1152810516 17:82379750-82379772 CCCCATCCACACCCAGGCAGGGG - Intergenic
1154240093 18:12645468-12645490 TCTCACCCACACATAAAAAGTGG + Intronic
1160019666 18:75170588-75170610 CCTCACCCATACGCGAGAAGCGG - Intergenic
1160031003 18:75259958-75259980 CATCACACACACTCAAGAAGTGG - Intronic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160828914 19:1093746-1093768 CATCACCCACAGCAAGGAAGGGG + Intronic
1160967219 19:1752059-1752081 CCCCTCCCACACCAGAGAAGGGG + Intergenic
1161012484 19:1967410-1967432 CCCCACCCTCACTGAAGAAGGGG - Intronic
1161251079 19:3280691-3280713 TCTCACCCACACCTGAGAACAGG - Intronic
1161667390 19:5585609-5585631 CCACACCCACCTCCAGGAAGGGG + Intergenic
1161873340 19:6887629-6887651 CCTCACACTCACCCCAGAAGAGG - Exonic
1162301552 19:9847819-9847841 CCTCACCCACACCCAAGAAGAGG - Intronic
1162752133 19:12835317-12835339 CCTAACCCACCCCCGAGAGGCGG - Exonic
1164521911 19:28985991-28986013 GCCCACCCACAGACAAGAAGGGG - Intergenic
1164825734 19:31283733-31283755 CCTCACCAACACTCAGCAAGTGG + Intronic
1164909180 19:31992002-31992024 TCTCACCCACACCAAGGAAGGGG + Intergenic
1165325155 19:35110091-35110113 AGTCACCCACAGCCAGGAAGGGG + Intergenic
1165697247 19:37909786-37909808 CATACCACACACCCAAGAAGAGG + Intronic
1166379664 19:42349389-42349411 CCCCACCCCCTCCTAAGAAGAGG - Intronic
1166896401 19:46024682-46024704 CCTCACCCCGACCCCAGAAGTGG + Intergenic
1166909676 19:46143873-46143895 CCTCACTCAGACCCAACACGTGG + Intronic
1167104099 19:47420262-47420284 CCTCACCCTCAGCCAAGACTTGG + Intergenic
1167597811 19:50436502-50436524 CCTCACCCCCACCCCACAGGGGG - Intronic
1167713563 19:51126331-51126353 CCTCAGCCTCAAACAAGAAGAGG + Intronic
1168153988 19:54463232-54463254 CCTCGCGCACACCCAGAAAGCGG + Exonic
925748814 2:7068877-7068899 CCACACACACACCTAAGTAGAGG + Intergenic
926787787 2:16535724-16535746 CCACACCCAGCCCCAAGAACCGG - Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927240298 2:20915075-20915097 CCTCACCCACCCACAAGGAGAGG - Intergenic
931021963 2:58056086-58056108 CCTCCCCCACCCCCTAAAAGAGG + Intronic
932758263 2:74423515-74423537 CCTCACCCACACAGATGAAGTGG - Exonic
932862204 2:75305856-75305878 ACTCCCCCCCACCCAAGAATTGG + Intergenic
933941017 2:87245319-87245341 CCCCAGCCACACCAAAGAGGGGG + Intergenic
935149589 2:100421656-100421678 CCACACCTAAACCCAACAAGTGG - Intergenic
935183101 2:100707416-100707438 CGGCACCCACACCCAGGAAATGG + Intergenic
935321370 2:101892568-101892590 ACTCCCCCACCCCCAAGAAAAGG - Intronic
935350945 2:102151525-102151547 CCTCTCCCACACCCATGAGGAGG - Intronic
935589631 2:104834732-104834754 GCTCACGCACACCTTAGAAGGGG - Intergenic
936146911 2:109986519-109986541 CCCCACCCCAACCCCAGAAGAGG + Intergenic
936197781 2:110384964-110384986 CCCCACCCCAACCCCAGAAGAGG - Intergenic
936274685 2:111084295-111084317 ACACACACACACACAAGAAGTGG + Intronic
936352122 2:111720693-111720715 CCCCAGCCACACCAAAGAGGGGG - Intergenic
939085237 2:137710471-137710493 CCTTAGCCACACCAAAGAATTGG + Intergenic
939580695 2:143942199-143942221 CCTCTCCCAACCCCAAGGAGAGG - Exonic
940683963 2:156822787-156822809 CTGCTCCCACACCCATGAAGAGG + Intergenic
941545644 2:166847137-166847159 CCTCTCCCCCACTCAGGAAGTGG + Intergenic
941951617 2:171161274-171161296 CCTGACCCACACCCAACACGGGG + Intronic
942557694 2:177188685-177188707 GCTCACCCACACACCAGAAGGGG + Intergenic
943848510 2:192685494-192685516 CCTGACCCACACTCAAGGGGAGG + Intergenic
947511513 2:230758720-230758742 CCCCACACACACCCAAGAAAAGG - Intronic
947625865 2:231618278-231618300 CCCCACCCACACCCAATGGGGGG - Intergenic
948108571 2:235435394-235435416 TCTTGCCCACACCCAAGCAGAGG - Intergenic
1169445495 20:5667781-5667803 CCTCACTCACAGCCAGCAAGGGG + Intergenic
1170569124 20:17622952-17622974 CCTGACGCACACCTGAGAAGCGG + Intronic
1172042105 20:32052774-32052796 CCCCGCCCCCCCCCAAGAAGGGG - Intronic
1172589327 20:36106142-36106164 CCCCACCCACACCCAGCAGGAGG - Intronic
1174263327 20:49313377-49313399 CTTCACCCAGACCCATGGAGAGG + Intergenic
1175321953 20:58094489-58094511 CCCCAGCCACAGCCTAGAAGGGG + Intergenic
1175522310 20:59609649-59609671 CCTCTCCCACGCCCAGGAAGGGG - Intronic
1175608991 20:60334503-60334525 CCTGACCCACACCCAGGGAAAGG - Intergenic
1175804177 20:61818266-61818288 CCTCCCCCACACCCCAGCAAGGG - Intronic
1175858532 20:62135964-62135986 CATTACCCCCACCCAAGAAATGG - Intergenic
1175874604 20:62223451-62223473 CAACACCCAGCCCCAAGAAGGGG + Intergenic
1175907494 20:62388050-62388072 CCTCTTCCACCCTCAAGAAGCGG - Intronic
1176310233 21:5145448-5145470 CCTCCCCCACAGCCCAGACGCGG + Intronic
1176705584 21:10118381-10118403 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1177516473 21:22158278-22158300 TCTCAGCCACACCCAAGGGGAGG - Intergenic
1178683149 21:34690132-34690154 CCCCACCCTCACCCATCAAGAGG - Intronic
1179194336 21:39151539-39151561 CCTCACTTACATCCAAGGAGAGG + Intergenic
1180163835 21:46010139-46010161 CCGCACCCTCACTCAAGATGTGG - Intergenic
1180687223 22:17678953-17678975 CTTCCCCCACACCCAGGTAGGGG + Intronic
1180932247 22:19600192-19600214 CCTCACCTCCACCCAAGTCGAGG - Intergenic
1181058566 22:20271174-20271196 CCACACCCACACCCAAAATGTGG + Intronic
1182131413 22:27855605-27855627 CCTCACCCCCACCCCGGAACCGG + Intronic
1182317276 22:29456373-29456395 GCTCTCCCATTCCCAAGAAGGGG - Intergenic
1183223995 22:36536807-36536829 TCTCTCCCACACCCAACAAAAGG + Intergenic
1184598597 22:45529109-45529131 TCAGACCCTCACCCAAGAAGTGG - Intronic
951217551 3:20039941-20039963 CCTCACCCACACCCAGGGATTGG + Intergenic
951841070 3:27034928-27034950 CCACCCCCATACCCAAGCAGGGG + Intergenic
952310078 3:32180734-32180756 CCTCACCCCCACCCATGAGAAGG - Intergenic
953091415 3:39730121-39730143 CCTCACCCCCACCCCACAACAGG + Intergenic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953849744 3:46456435-46456457 ACTCACCCAAACCCAGCAAGTGG + Intronic
953913734 3:46905428-46905450 CCCCACCCACACCCCAGGACAGG + Intergenic
953957964 3:47246090-47246112 CTTCATCCACAAGCAAGAAGAGG + Intronic
955503105 3:59604638-59604660 CCTCACCCCCACCAACAAAGTGG + Intergenic
956189639 3:66596432-66596454 CCCCACCCACACCCCAGACTAGG - Intergenic
957448112 3:80340543-80340565 CCCCACCCACACCTAAGGGGTGG - Intergenic
960565678 3:119129152-119129174 CCTCACCCCCACCCCACAACAGG - Intronic
960843917 3:121988967-121988989 CTTCACCCTCACCGAGGAAGTGG - Intronic
960853453 3:122079270-122079292 CCTCACCCCCACCCAGGAAGAGG - Intronic
961088644 3:124091230-124091252 CCTCACCCTGCCCCAACAAGCGG - Intronic
963771327 3:149389228-149389250 TCCCACCCACACTCAAGAGGAGG + Intergenic
963979903 3:151525932-151525954 TCTCACCCACACTCAAGGGGAGG + Intergenic
964188382 3:153974729-153974751 CTTCACCCTCAGCCAGGAAGTGG + Intergenic
966028715 3:175319080-175319102 CCTCACCCCCACCCATGTGGGGG - Intronic
966946094 3:184778064-184778086 CATCCCCTACCCCCAAGAAGAGG + Intergenic
968278229 3:197456888-197456910 CTCCCTCCACACCCAAGAAGGGG + Intergenic
969697038 4:8740809-8740831 CCTCTCCCACACCCAGGCTGGGG + Intergenic
970149083 4:13070000-13070022 TCTCACACACACACACGAAGAGG - Intergenic
971921910 4:32951534-32951556 CCTCACACACATCCCATAAGTGG + Intergenic
971942500 4:33234077-33234099 TCTCACCCACACTCAAGAGAAGG - Intergenic
972468914 4:39384940-39384962 CCTCCCCCACCCCCCAGCAGCGG - Intergenic
972902485 4:43701435-43701457 CCCCACACACACCCTAGCAGTGG - Intergenic
973658077 4:53072159-53072181 CATCACCTACACCTAAGAAGAGG + Intronic
973743860 4:53944677-53944699 CATGACCCCAACCCAAGAAGTGG + Intronic
974995690 4:69156511-69156533 CATAACCTACATCCAAGAAGTGG - Intronic
976044028 4:80923177-80923199 GTTCACCCACAGCCAGGAAGAGG + Intronic
977870061 4:102080750-102080772 TCACACCCACACCCAAGGAGGGG + Intergenic
978491269 4:109314420-109314442 CATCACCTCCACCCATGAAGTGG - Intergenic
981053491 4:140335271-140335293 CATGACCCACAGCCAGGAAGTGG - Intronic
981427364 4:144618846-144618868 CTCCACAGACACCCAAGAAGGGG + Intergenic
982228026 4:153183484-153183506 CCTGAGCGACACCCAAGGAGTGG + Intronic
984180805 4:176480240-176480262 CCCCACCCACCCCCAGCAAGTGG - Intergenic
984763289 4:183380521-183380543 CCTCAGCCACACTCAAGAGCTGG - Intergenic
985106756 4:186507148-186507170 TCCCACCCACACTCAAGGAGAGG + Intronic
985380797 4:189392640-189392662 CCCCACCCCCACCCAACAACAGG + Intergenic
986745393 5:10739511-10739533 CCTCACCCAGGACCAAGAAGAGG + Intronic
987226248 5:15844657-15844679 CATCACTCAAACCCAAGAGGAGG + Intronic
987744741 5:21955771-21955793 CATCACACAAACCCAAGTAGTGG - Intronic
987819720 5:22947358-22947380 TTCCACCCACACCCAAGGAGGGG - Intergenic
988692640 5:33588248-33588270 CCTCCCACACACCCCAAAAGTGG - Intronic
989339525 5:40357735-40357757 CCTCACCATACCCCAAGAAGTGG + Intergenic
989628843 5:43460606-43460628 CCTCCCCTACACCCCAGAAGTGG + Intronic
989978368 5:50612182-50612204 CCTCCCCCCCACCCCAGAATAGG - Intergenic
992995106 5:82324721-82324743 CCTCACCCGCCCCCAAGAAGGGG - Intronic
993921071 5:93803452-93803474 CCGCCCCCCCACCCAAAAAGAGG + Intronic
994028459 5:95113415-95113437 CCTCCCCCATCCCCAAGCAGTGG + Intronic
995684813 5:114760766-114760788 CCTCACCCCCACCCCACAACAGG + Intergenic
995720275 5:115123238-115123260 CCTCCCCCACACCCCACAACAGG - Intergenic
998004396 5:138647575-138647597 CCACAGCCACACCCAACAACTGG - Intronic
998146953 5:139734490-139734512 CCTCACCCTCACCCACGAAAAGG - Intergenic
1001389056 5:171364042-171364064 CCTCAGCCAAACCCCAGATGCGG + Intergenic
1001789469 5:174443566-174443588 CCTCTCCCACAACCTAGAACAGG + Intergenic
1002070098 5:176674021-176674043 CCTCACCCACCCCCACCCAGTGG - Intergenic
1002314597 5:178334933-178334955 CCTCCCCCACACCCCAGACTTGG + Intronic
1003078518 6:3002675-3002697 CCTCACCCCTACCCTAGGAGGGG + Intronic
1004352617 6:14903419-14903441 ACTTACCCACAGCCAGGAAGTGG - Intergenic
1004759012 6:18645367-18645389 TTCCACCCACACTCAAGAAGAGG - Intergenic
1005958829 6:30682607-30682629 CCCCACCCCCACCCAAGCAGCGG + Intronic
1006410481 6:33870703-33870725 CCTCACCCACACCCCATACTGGG - Intergenic
1008535788 6:52505277-52505299 AAGCACCCACACACAAGAAGAGG + Intronic
1008622300 6:53282446-53282468 CCTCACCCACACCCAGGGGAGGG - Intronic
1009670345 6:66740804-66740826 CCACACACACACCCAGGAAGGGG - Intergenic
1010787432 6:80020912-80020934 CCAAACCCATCCCCAAGAAGGGG + Intronic
1010923037 6:81708108-81708130 CCTGATCCAGACCCAAGAAAGGG + Intronic
1011136637 6:84107290-84107312 CCGCTCCTACAACCAAGAAGGGG - Intergenic
1012037598 6:94162785-94162807 TCCCACCCATACTCAAGAAGAGG - Intergenic
1012356168 6:98316971-98316993 TCTCACCCACACTCAAGAGAAGG - Intergenic
1013880467 6:114893270-114893292 CTTCACCCAGACCCAAGAATTGG + Intergenic
1017145380 6:151229984-151230006 CCTCACCCCCACCCCACAAAGGG + Intergenic
1018425729 6:163678897-163678919 TCCCACCCAAACCCAAGAGGAGG - Intergenic
1022505740 7:30907875-30907897 CCTCAGCCACACCCAAGGTCTGG + Intergenic
1023970588 7:44987861-44987883 CCCCACCCACCCCCAGGCAGAGG + Intergenic
1024631438 7:51250899-51250921 CCTCAGCCACATCAAAGAATTGG + Intronic
1025818733 7:64944066-64944088 CCTCACACACTCCTGAGAAGTGG + Intergenic
1026033243 7:66813383-66813405 CCCCACCAACACCACAGAAGAGG - Intergenic
1026273132 7:68853538-68853560 CCTCACCCACACACAAGAGGTGG + Intergenic
1026277146 7:68889926-68889948 CCTCACCCAGCCCCATGAGGTGG + Intergenic
1026736763 7:72953946-72953968 CCAAACCCACACCCACGAAAGGG - Intergenic
1027106971 7:75411117-75411139 CCAAACCCACACCCACGAAAGGG + Intergenic
1027233909 7:76286830-76286852 CCCCAGCCCCACCCAAGAGGAGG + Exonic
1028406012 7:90474727-90474749 CCTCACCCACACCACAGAGGTGG + Intronic
1032394702 7:131581223-131581245 CCTGACTCACACCCAGGCAGAGG + Intergenic
1034502764 7:151461538-151461560 CGTTACCCTCCCCCAAGAAGGGG - Intergenic
1035736971 8:1895911-1895933 CCTCAACCACACCCTAGAAATGG - Intronic
1036086527 8:5618636-5618658 CCACACACACACCCAAGACCAGG - Intergenic
1036259988 8:7231817-7231839 CCTCACACACTCCCCACAAGGGG + Intergenic
1036312031 8:7690386-7690408 CCTCACACACTCCCCACAAGGGG + Intergenic
1038134583 8:24771400-24771422 CCCCACCCACACACAGAAAGGGG + Intergenic
1042774754 8:72418350-72418372 AGTCACTCACACCCAAGATGAGG - Intergenic
1043119125 8:76300511-76300533 TCACACCCACACTCAAGTAGTGG + Intergenic
1043349670 8:79345069-79345091 TCTCACCCACACTCAAGGGGAGG + Intergenic
1043396439 8:79842395-79842417 CCATACCAACACCTAAGAAGGGG + Intergenic
1043516666 8:81001126-81001148 CCTCAGCCACACCTGAGAGGTGG - Intronic
1044322129 8:90814422-90814444 CCCAACCCACACCCAAGGAGAGG + Intronic
1044920927 8:97168555-97168577 CCTCACCCACCCTCTACAAGTGG + Intergenic
1044932488 8:97263129-97263151 CCTAGCCCGCAACCAAGAAGAGG + Intergenic
1045507063 8:102786215-102786237 CCTCACCCCCTCCTAACAAGGGG + Intergenic
1048847494 8:138614715-138614737 CCCCAACCCCACCCAAAAAGGGG - Intronic
1049251665 8:141592477-141592499 ACACACACACACCCAAGCAGAGG - Intergenic
1049251702 8:141592725-141592747 CCACACACACACCCAAGCCGAGG - Intergenic
1051942783 9:22529158-22529180 CCCCACCCACCCCCACAAAGTGG + Intergenic
1052476722 9:28970519-28970541 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1052974234 9:34400097-34400119 CCTCACCCCAGCCCAAGACGTGG - Exonic
1053642864 9:40105505-40105527 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1053763289 9:41359985-41360007 CTTCACCCAGCCCCAAGATGAGG - Intergenic
1054323722 9:63702756-63702778 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1054541898 9:66271152-66271174 CTTCACCCAGCCCCAAGATGAGG - Intergenic
1055373658 9:75625790-75625812 CCTCACACACCCCCAGGAAAGGG - Intergenic
1055502338 9:76913863-76913885 CCTCACCCCTTCCCAAAAAGTGG + Intergenic
1056205315 9:84314208-84314230 CCTCACACACACACAAAAAAGGG - Intronic
1056288416 9:85114690-85114712 CCTCACGGAAACCCAAGAGGAGG - Intergenic
1057125412 9:92612385-92612407 CCCAATCCACAGCCAAGAAGAGG - Intronic
1057369692 9:94459295-94459317 CCTGACCAACACCCCAGAACGGG + Exonic
1059555615 9:115277191-115277213 CCTCACCCATACCCTGGCAGCGG - Intronic
1059596714 9:115728682-115728704 CCTCACCAAAACCCAAGCAATGG + Intergenic
1060433842 9:123575676-123575698 TCTAGCCCACACCCAAGTAGGGG + Intronic
1060934774 9:127508585-127508607 CCTCAGCGGCACCCAGGAAGGGG - Intronic
1061246113 9:129401953-129401975 CCTCACCCCCATCCAAGAGAGGG + Intergenic
1062040897 9:134403837-134403859 CCTCACCCACACCCACCCCGGGG - Intronic
1062099385 9:134720283-134720305 GCTCACCCAAGCCCAAGCAGGGG + Intronic
1062494367 9:136824871-136824893 CCTCACCCCAAACCAGGAAGAGG - Intronic
1062542211 9:137046453-137046475 CCTCACCCGCACCCGCGATGGGG + Intergenic
1062677552 9:137756231-137756253 GCACACCCACTGCCAAGAAGGGG - Intronic
1202790617 9_KI270719v1_random:88490-88512 CTTCACCCAGCCCCAAGATGAGG + Intergenic
1185479560 X:435792-435814 CCTCACCCACACCCGGGACCTGG - Intergenic
1185936493 X:4262614-4262636 CCTGCCCCATACCCAAGAGGAGG - Intergenic
1187656538 X:21481508-21481530 TCTCAACCACACTGAAGAAGAGG - Intronic
1188042710 X:25388485-25388507 CCTCCCCCACTACCAGGAAGTGG + Intergenic
1188051152 X:25488396-25488418 CCCCACCCACAGATAAGAAGCGG - Intergenic
1189138413 X:38574880-38574902 TCTCACCCACACCCAAGCAGAGG - Intronic
1190442455 X:50488770-50488792 CCCCACCCCCACCCAACAACAGG + Intergenic
1192546366 X:72018187-72018209 CCTCACCCCCACACAAGCAAAGG - Intergenic
1192712997 X:73611167-73611189 CCTCTCCCACACCCCACAACAGG + Intronic
1193274681 X:79571215-79571237 CCTCCCCCTGACCCAGGAAGTGG - Intergenic
1193425711 X:81338289-81338311 CCTCAGACACACCCAAGAAAGGG - Intergenic
1193841458 X:86412988-86413010 CCTCTCCTACAACCAAGAAAAGG - Intronic
1195706470 X:107741353-107741375 CCTCAACCACACCCCAGCAAGGG + Intronic
1195763770 X:108274942-108274964 TCCCACCCACACTCAAGAGGAGG + Intronic
1196378804 X:115067070-115067092 ACACACACACACTCAAGAAGGGG - Intergenic
1196840154 X:119852573-119852595 CCTCACCCCCACCCAGGATTTGG + Intronic
1197075582 X:122349542-122349564 CCTCACCCACCCCCGAGCAGTGG + Intergenic
1197215341 X:123861433-123861455 CCACCCCCACATTCAAGAAGTGG + Intronic
1197953020 X:131918341-131918363 CCTCCCCCACTCCCCAGAAGTGG + Intergenic
1199139013 X:144288013-144288035 CCTCCCCCATCCCCCAGAAGAGG - Intergenic
1200045542 X:153398980-153399002 CCTCACCCCCACACACGTAGGGG - Intergenic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic
1201575312 Y:15456118-15456140 CCTCACCCATACCCAGAAGGCGG - Intergenic
1201753463 Y:17460159-17460181 CCTTCCCCACACCCAAGGTGTGG + Intergenic
1201848090 Y:18445824-18445846 CCTTCCCCACACCCAAGGTGTGG - Intergenic
1202082487 Y:21098817-21098839 CCTCTCCCACACCCCACAACAGG + Intergenic