ID: 1162302497

View in Genome Browser
Species Human (GRCh38)
Location 19:9851929-9851951
Sequence GGCCCCGGTATCCGAGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162302492_1162302497 10 Left 1162302492 19:9851896-9851918 CCATTTATTATTCGTTGGTTTCG No data
Right 1162302497 19:9851929-9851951 GGCCCCGGTATCCGAGTTCCCGG No data
1162302491_1162302497 11 Left 1162302491 19:9851895-9851917 CCCATTTATTATTCGTTGGTTTC No data
Right 1162302497 19:9851929-9851951 GGCCCCGGTATCCGAGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162302497 Original CRISPR GGCCCCGGTATCCGAGTTCC CGG Intergenic