ID: 1162302497 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:9851929-9851951 |
Sequence | GGCCCCGGTATCCGAGTTCC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162302492_1162302497 | 10 | Left | 1162302492 | 19:9851896-9851918 | CCATTTATTATTCGTTGGTTTCG | No data | ||
Right | 1162302497 | 19:9851929-9851951 | GGCCCCGGTATCCGAGTTCCCGG | No data | ||||
1162302491_1162302497 | 11 | Left | 1162302491 | 19:9851895-9851917 | CCCATTTATTATTCGTTGGTTTC | No data | ||
Right | 1162302497 | 19:9851929-9851951 | GGCCCCGGTATCCGAGTTCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162302497 | Original CRISPR | GGCCCCGGTATCCGAGTTCC CGG | Intergenic | ||