ID: 1162303404

View in Genome Browser
Species Human (GRCh38)
Location 19:9857066-9857088
Sequence AGTGAGGGGTTAGAGGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162303398_1162303404 -2 Left 1162303398 19:9857045-9857067 CCAATATGTTGTTCAGTTGTGAG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG 0: 1
1: 0
2: 2
3: 34
4: 299
1162303395_1162303404 30 Left 1162303395 19:9857013-9857035 CCAGGGATGAGGGAAGACTCAAA 0: 1
1: 0
2: 3
3: 13
4: 218
Right 1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG 0: 1
1: 0
2: 2
3: 34
4: 299
1162303397_1162303404 -1 Left 1162303397 19:9857044-9857066 CCCAATATGTTGTTCAGTTGTGA 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG 0: 1
1: 0
2: 2
3: 34
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162303404 Original CRISPR AGTGAGGGGTTAGAGGCCAA GGG Intronic
903260739 1:22130410-22130432 AGTGATGGGCTAGAGGTCTAGGG + Intronic
904292338 1:29496103-29496125 AGTCAGGGGTAAGAGGTGAAAGG + Intergenic
905623826 1:39473566-39473588 AGTGAGGAGTCAGTGGCCAGTGG - Intronic
905671446 1:39793122-39793144 AGTGAGGAGTCAGTGGCCAGTGG + Intergenic
906287200 1:44595222-44595244 AGGTAGGGGTGGGAGGCCAAAGG + Intronic
906713715 1:47951709-47951731 GGTGAGGGGTCAGAGGACACCGG - Intronic
909062893 1:70899541-70899563 AGTGAGGGGTTAGAGGAAATCGG + Intronic
909212036 1:72836257-72836279 TGTCAGGGGTTGGAGGGCAAGGG + Intergenic
911959734 1:104286023-104286045 AGTGAGGAGCTAGAGGAGAAGGG - Intergenic
913163357 1:116165118-116165140 AGTGAGGGGCCTGAGGCCCAGGG - Intergenic
913576491 1:120180534-120180556 AGTGAAGGGTTAGAGGGGAAGGG + Intergenic
914558397 1:148791972-148791994 AGTGAAGGGTTAGAGGGGAAGGG + Intergenic
914614438 1:149338258-149338280 AGTGAAGGGTTAGAGGGGAAGGG - Intergenic
914717520 1:150264943-150264965 AGTGAGGGGGTAGAGGACTTTGG - Exonic
916943342 1:169699323-169699345 AGTGAGGGGTTAGCTGGCTAAGG - Intronic
917730535 1:177870585-177870607 AGAGAGGGGTCTGGGGCCAACGG + Intergenic
920679139 1:208059462-208059484 AGAGAAGGGTCAGAGTCCAAAGG - Intronic
923399172 1:233599790-233599812 GGTGAGGGGGTAGAGGACACCGG + Intergenic
923437823 1:233984554-233984576 AGTGAGGGCTTACAGGTCAGAGG + Intronic
923884300 1:238138087-238138109 AGAGAGAGCTGAGAGGCCAAAGG + Intergenic
923980915 1:239322460-239322482 AGGGAGGGGTGAGAGGCGAGAGG - Intergenic
924291473 1:242541107-242541129 GGTGATGGTTTAGAGGCCACAGG + Intergenic
1064458249 10:15508544-15508566 AGTGTGGGGTGAGAGGCCACTGG + Intergenic
1066811166 10:39337610-39337632 TGTGAGCAGTTTGAGGCCAATGG - Intergenic
1066812092 10:39353245-39353267 ACTGAGTGGTTTGAGGCCTATGG - Intergenic
1066812753 10:39362014-39362036 TGTGAGTGGTTTGAGGCCATTGG - Intergenic
1066815366 10:39402038-39402060 ACTGAGTGGTTTGAGGCCTATGG + Intergenic
1066933252 10:41793892-41793914 TCTGAGTGGTTTGAGGCCAATGG + Intergenic
1068219162 10:54021512-54021534 TGTGAGGGGTGAGGGGCTAAAGG - Intronic
1069655049 10:70081524-70081546 TGTGACGCGTCAGAGGCCAAGGG + Intronic
1069919702 10:71808980-71809002 AGTGAGAGCTCAGAGGACAAAGG - Intronic
1070054576 10:72923086-72923108 AGTCAGGGGTTAGAGACCAGTGG - Intronic
1072223129 10:93344589-93344611 AAGGAGGGGTGAGAGGCCAGGGG + Intronic
1073468388 10:103707932-103707954 AGGGAGGGTTTGGAGGCAAAAGG - Intronic
1074170584 10:110931278-110931300 AGGTAGGGGATAGAGGCTAACGG - Intronic
1074505217 10:114063686-114063708 AGGGAAGGGTTAGAGAACAAGGG + Intergenic
1074506470 10:114075338-114075360 ATTGAGTGGGTAGAGGCCAGGGG + Intergenic
1074807612 10:117069135-117069157 AGTGAGGTCTCAGAAGCCAAGGG + Intronic
1075213718 10:120513543-120513565 AGATAGGAGTTGGAGGCCAAGGG + Intronic
1075517697 10:123121860-123121882 AGTGAGAGCATAGAGGCCATGGG + Intergenic
1075883280 10:125873380-125873402 AGTGAGGGATTAGAGGCCTTTGG - Intronic
1076995377 11:295058-295080 AGTGGGGGATGAGAGGCCAGAGG - Exonic
1077074065 11:692101-692123 AGGAAGGGGTCAGAGACCAAGGG - Intronic
1077102392 11:827967-827989 AGTGGGGCGTCAGAGGCGAAGGG + Intronic
1079117902 11:17652228-17652250 GCTGGGGGGCTAGAGGCCAAAGG - Intergenic
1080108946 11:28544078-28544100 AGTGACAGGCTACAGGCCAAAGG + Intergenic
1080924274 11:36739849-36739871 AGTGAGGGGATAGGGGGCCAAGG - Intergenic
1081656462 11:44860851-44860873 AGTGGGTGGTGAGAGGGCAAAGG + Intronic
1082149939 11:48725946-48725968 AGTGAGTGCTTTGAGGCCTATGG + Intergenic
1082150063 11:48728009-48728031 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1082151363 11:48744145-48744167 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1082294731 11:50425976-50425998 AGAGAGCGCTTAGAGGCCAATGG + Intergenic
1082572833 11:54763642-54763664 AGGGAGAGGCTAGAGACCAAAGG - Intergenic
1082598697 11:55119722-55119744 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1082599048 11:55126592-55126614 GGTGAGCGGTTTGAGGCCCATGG + Intergenic
1082599094 11:55127452-55127474 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1082599506 11:55132289-55132311 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1083464205 11:62834405-62834427 AGTGAGTGTTTAGAGGGGAAGGG - Exonic
1083661988 11:64255685-64255707 AGTGTGGGGTGAGAAGCCAGGGG - Intronic
1083662812 11:64259628-64259650 AGTCAGGGGTGAGAGGTCAGAGG - Intronic
1084735191 11:71100893-71100915 TATGAGGGGTTAGAGGGCAAGGG + Intronic
1084965634 11:72743061-72743083 AGTAAGGAGATAGAGGCTAATGG - Intronic
1086839410 11:91666897-91666919 AGTGGGAGGTTAGACACCAAAGG + Intergenic
1093607249 12:21107503-21107525 AGTGTGGTGTAAGAGCCCAAGGG + Intronic
1094398255 12:30032300-30032322 ATTGAGAGGTTAGAAGCCCATGG + Intergenic
1095061920 12:37705642-37705664 AGTGAGCAGTTTGAGGCCTATGG - Intergenic
1095063837 12:37739781-37739803 AGTGAGCGGTTTGAGGCCTATGG + Intergenic
1095063917 12:37741322-37741344 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1095064291 12:37748343-37748365 CGTGAGCGGTTTGTGGCCAATGG + Intergenic
1095067332 12:37793700-37793722 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1095067830 12:37803467-37803489 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1095067876 12:37804290-37804312 CGTGAGGGCTTTGAGGCCTATGG + Intergenic
1095071322 12:37852363-37852385 TCTGAGGGGTTTGAGGCCTATGG + Intergenic
1095071659 12:37858607-37858629 TCTGAGGGGTTTGAGGCCTACGG - Intergenic
1095659971 12:44720973-44720995 AGTGAGGGGTTAGGAGGCAAAGG + Intronic
1095695487 12:45139042-45139064 ATTGAGTGCTTAAAGGCCAATGG + Intergenic
1095695539 12:45139701-45139723 ATTGAGTGCTTAAAGGCCAATGG - Intergenic
1099905307 12:88763304-88763326 AGTGAGGGGAGAGAGGTCAGTGG + Intergenic
1102734320 12:115144821-115144843 ACTGGGTGGTTAGAGGCCTAGGG - Intergenic
1102817322 12:115877614-115877636 AGAGTGGGGTTGGGGGCCAATGG + Intergenic
1103147217 12:118605525-118605547 AGGGAGTGGTTAGCAGCCAAGGG - Intergenic
1103303804 12:119948484-119948506 AGTGCGGGATTATAGGCCTAAGG - Intergenic
1103626188 12:122221898-122221920 AGTGAGGGGTTTTAGGGCTATGG + Intronic
1103893081 12:124254417-124254439 ACTGAGGGGCTGGAGGCTAAAGG - Intronic
1103986212 12:124769070-124769092 AGTGAGGGGAGAGAGGCTGAAGG + Intergenic
1106486742 13:30179320-30179342 AGTGAGGGGTGAGAGGGCAAGGG - Intergenic
1106577546 13:30989765-30989787 TGTCAGGGGGTAGAGGGCAAGGG - Intergenic
1111287957 13:86119881-86119903 AGTGGGGGCTTAGAGGTCACAGG + Intergenic
1113579496 13:111419053-111419075 AGGGAGGAGTGAGAGGCTAAGGG + Intergenic
1113996095 14:16074152-16074174 TCTGAGGGGTTTGAGGCCTACGG + Intergenic
1113996209 14:16076533-16076555 TGTGAGGGGTTTGTGGCCTATGG + Intergenic
1113998740 14:16123151-16123173 TGTGAGGGCTTTGAGGCCTATGG - Intergenic
1115505279 14:34087767-34087789 TGTGAGGTGTTAGAGACCAGAGG + Intronic
1117338572 14:54775213-54775235 AGGGTGGGGAGAGAGGCCAAAGG + Intronic
1118121739 14:62853273-62853295 AGTGAGGACATAGAGGCCAACGG - Intronic
1118446202 14:65853321-65853343 AGTCACAGGTTTGAGGCCAAAGG - Intergenic
1122246851 14:100409245-100409267 AGTGAGGAGTTGCAGGCCACTGG + Intronic
1122322164 14:100861666-100861688 ACTGAGGGGCAAGGGGCCAAAGG + Intergenic
1123227957 15:17065942-17065964 TGTGAGGGCTTTGAGGCCTATGG + Intergenic
1123880651 15:24675681-24675703 AGGCAGGGGTCAGAGGGCAAAGG - Intergenic
1123963177 15:25428079-25428101 AGTGGGGAGTGAGAGGACAAAGG + Intronic
1126950199 15:53872382-53872404 AATGAGGGAGTAGTGGCCAATGG + Intergenic
1127991553 15:64122574-64122596 GGTGAGGGGTGAGGGGCCAAGGG - Intronic
1129664452 15:77571838-77571860 AGTGGGGGGCCAAAGGCCAAAGG - Intergenic
1130013593 15:80170970-80170992 AGATAGGGGTTAGAGGCCGTGGG + Intronic
1130651453 15:85764303-85764325 AGTGAGGGGACAGAAGCCACGGG + Intronic
1132346338 15:101111345-101111367 AGGGAGGAGTGAGAGGCCGATGG - Intergenic
1132347506 15:101117217-101117239 AGTGATGGGCCAGAGGCCATTGG + Intergenic
1132731892 16:1366856-1366878 AGGGAGGGGTGAAAGGGCAAGGG + Intronic
1133583882 16:7172832-7172854 AGTGAGGGTTTAGAGAACATGGG + Intronic
1136915090 16:34182188-34182210 TGTGAGGGCTTTGAGGCCTATGG - Intergenic
1136915154 16:34183378-34183400 TGTGAGGGCTTTGAGGCCTATGG - Intergenic
1137076693 16:35974202-35974224 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1137081338 16:36061088-36061110 ATGGAGGGCTTAGAGGCCTATGG + Intergenic
1137858400 16:51820021-51820043 AGAGAGGAGTTAGAGACCCATGG - Intergenic
1138356373 16:56384215-56384237 AGTGGGTGGGTAGAGGCCAGAGG - Intronic
1141319749 16:82996295-82996317 AGTCATGGGGTAGAGGCCACTGG - Intronic
1141396915 16:83713321-83713343 AATGTGGGGTGGGAGGCCAATGG - Intronic
1141477761 16:84284980-84285002 AGAGAAGGGCTAGAGCCCAATGG - Intergenic
1142261831 16:89046414-89046436 AGTGAGGGGACAAAGACCAAAGG + Intergenic
1142312690 16:89323350-89323372 GGTGAGAGGTGAGAGGCCAGTGG - Intronic
1142773047 17:2113644-2113666 AGTGATGGTTTTGAGGCCATGGG - Intronic
1143921536 17:10334148-10334170 CGTGAGGGGTTAGAGGACAGGGG + Intronic
1145013154 17:19381306-19381328 AGTGAGGGCTTCGCGGTCAAAGG - Exonic
1145280411 17:21463642-21463664 AGTGAGGGGGTGGGGGCCATGGG - Intergenic
1145416926 17:22722721-22722743 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1145417430 17:22730606-22730628 TGTGAGGGCTTTGAGGCCTATGG + Intergenic
1148063140 17:44850284-44850306 GGTGAAGGGTTTGATGCCAAGGG + Exonic
1148561594 17:48609878-48609900 AGGGAGGGGGCTGAGGCCAAAGG - Intronic
1148563970 17:48622292-48622314 AGTGAGGTGTTGCAGCCCAAAGG - Exonic
1148875010 17:50681897-50681919 AGTGAGGGGTGAGGGGCCAGAGG - Intronic
1152004622 17:77672294-77672316 ACTGAGAAGTTAGAGGACAAGGG - Intergenic
1155247429 18:23923708-23923730 ATTGAGGTGGTAGAGGCCAGTGG + Intronic
1155935696 18:31751391-31751413 AGTGAAGGGTAAGAGGAAAAGGG - Intergenic
1159861184 18:73651472-73651494 AGAGAGGGAGCAGAGGCCAAGGG + Intergenic
1160377853 18:78427458-78427480 AGCCAGGGGTTGGAGGCCCAGGG - Intergenic
1160918400 19:1508336-1508358 AGGGAGGGGGTGGAGGCTAATGG + Intronic
1162095308 19:8306603-8306625 AGTGGGGGGTTGGAGGCTCATGG - Intronic
1162303404 19:9857066-9857088 AGTGAGGGGTTAGAGGCCAAGGG + Intronic
1163673976 19:18646101-18646123 AGAAAGGGGCAAGAGGCCAAAGG - Intronic
1164336779 19:24331142-24331164 AGGGAGCGCTTTGAGGCCAATGG + Intergenic
1164352415 19:27367277-27367299 AGTGACCGGTTTAAGGCCAATGG - Intergenic
1164357124 19:27450103-27450125 TGTGAGCTGTTAGAGGCCTATGG + Intergenic
1164357542 19:27457947-27457969 TGTGAGGGGTTTGAGGCCTATGG + Intergenic
1164360056 19:27496509-27496531 TGTGAGTACTTAGAGGCCAATGG + Intergenic
1165786532 19:38465008-38465030 CGTAAGGGGTAAGGGGCCAATGG + Intronic
1166477849 19:43144558-43144580 AGGGTGGGGTTGCAGGCCAAGGG - Intronic
1167320262 19:48793323-48793345 AAGGAAAGGTTAGAGGCCAAGGG - Intergenic
1167688755 19:50972503-50972525 AGTGAAGGGCCAGAGGCCAGAGG - Intergenic
1168318398 19:55494174-55494196 ACCCAGGGGTTAGAGGCCAGGGG + Intronic
925883518 2:8372807-8372829 AGACAAGGGTTAGAAGCCAAAGG + Intergenic
926341016 2:11904331-11904353 AGGGTGGGGTAAGGGGCCAATGG + Intergenic
927685771 2:25169277-25169299 AGGGAGGGATCAGAGGCCACAGG - Intergenic
928704233 2:33930359-33930381 AGTGATGGGGTAGAGGTCAATGG + Intergenic
929071178 2:38032229-38032251 AGTGAGGGGAAGGAAGCCAAGGG - Intronic
929560661 2:42954420-42954442 ACTGAGGGGTCAGAGGTCAAAGG + Intergenic
929579253 2:43071289-43071311 AGTCAGGGAGCAGAGGCCAAAGG + Intergenic
930914328 2:56668752-56668774 AGTGAGGTGTTAAATGCCATAGG + Intergenic
935067686 2:99665017-99665039 AGTGAGGGAGTAGAGGCCTATGG + Intronic
936078299 2:109415718-109415740 AGTGACGGTTTGGAGGCAAAGGG - Intronic
937044342 2:118843307-118843329 AGGGAGGGGGGAGAGGGCAAAGG + Intronic
937822003 2:126320726-126320748 AGTGAGGTGTTTTAGGCAAAGGG + Intergenic
938025003 2:127939950-127939972 AGTCAGAAGTTAGAGGCAAAGGG - Intergenic
938174986 2:129117603-129117625 ATTGAGGCCTAAGAGGCCAAGGG - Intergenic
938394269 2:130930910-130930932 GGTCAGGGGTCAGAGGTCAAAGG - Intronic
940604540 2:155903773-155903795 AGTGAGGAGGTACAGGACAAAGG + Intergenic
940856295 2:158730903-158730925 GGTGAGGAGTGAGAGGCCAGGGG - Intergenic
943787253 2:191891768-191891790 AGTGAGGGGATAAAAGCCCAAGG + Intergenic
944321691 2:198352230-198352252 AGTGAGGGTTTATAGGCAATTGG - Intronic
945148987 2:206768042-206768064 AGTGAGGGGCAAGAGGCTTAGGG + Intronic
946631000 2:221669059-221669081 GGTGAGGGGTTAAAGGCAAAAGG - Intergenic
948509790 2:238456121-238456143 GGTGAGGGGTTTGTGCCCAAGGG - Intergenic
948797691 2:240413109-240413131 AGGGAGGGGCCAGAGGCCAGGGG + Intergenic
1171353264 20:24521959-24521981 AGTGATATGTTAGGGGCCAAGGG - Intronic
1171742087 20:28908735-28908757 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1171764117 20:29243734-29243756 TGTGAGCGGTTTGAGGCCTATGG - Intergenic
1171765867 20:29275083-29275105 TGTGAGCGGTTTGAGGCCTAAGG - Intergenic
1171765927 20:29276284-29276306 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171765935 20:29276423-29276445 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171766512 20:29286588-29286610 TGTGAGCGGTTTGAGGCCTATGG - Intergenic
1171809345 20:29729305-29729327 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171809875 20:29737841-29737863 TGTGAGTGCTTGGAGGCCAATGG - Intergenic
1171864147 20:30466593-30466615 TCTGAGGGGTTTGAGGCCTATGG - Intergenic
1171864579 20:30474636-30474658 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1171909598 20:30934180-30934202 TGTGAGGGCTTTGAGGCCTATGG - Intergenic
1171973888 20:31581588-31581610 AGTGAGGGGGTGGAGGGGAAGGG + Intergenic
1173226411 20:41164843-41164865 AGTGAGCTGTTGGAAGCCAAGGG - Intronic
1173915480 20:46705177-46705199 AGTCAGGAGTTAGAGGCTGAAGG + Intergenic
1175796322 20:61773471-61773493 AGAAAGGGGTCAGAGGTCAAAGG - Intronic
1176325222 21:5390513-5390535 TCTGAGGGGTTTGAGGCCTACGG - Intergenic
1176482778 21:7320929-7320951 TCTGAGGGGTTTGAGGCCTATGG - Intergenic
1176483014 21:7325722-7325744 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1176483075 21:7326923-7326945 TGTGAGCGGTTTGAGGCCTATGG - Intergenic
1176761498 21:10799406-10799428 TGTGAGGGCTTTGAGGCCTATGG + Intergenic
1177171319 21:17659225-17659247 AGTGAGTCTTTAGAGGGCAAAGG - Intergenic
1179405619 21:41123007-41123029 AGTGAGGAGAGAGAGGTCAAAGG - Intergenic
1180310850 22:11230613-11230635 TGTGAGGGGTTTGTGGCCTATGG - Intergenic
1180310964 22:11232995-11233017 TCTGAGGGGTTTGAGGCCTACGG - Intergenic
1180311652 22:11245620-11245642 TGTGAGGAGTTTGAGGCCTATGG - Intergenic
1180401635 22:12435992-12436014 TCTGAGGGGTTTGAGGCCTATGG - Intergenic
1180739622 22:18043871-18043893 CTTGAGAGGTTAGAGACCAATGG + Intergenic
1181980300 22:26761366-26761388 AGGGAGAAGTTTGAGGCCAAGGG - Intergenic
1182308134 22:29385491-29385513 AGGCAGGGGTCAGAGTCCAAAGG + Intronic
1182368079 22:29792087-29792109 AGAGAGGAGTTAGAGCCCAAGGG - Intronic
1182544686 22:31068091-31068113 AGTCAGGAGTTTGAGACCAACGG + Intronic
1182812322 22:33127667-33127689 AGTGAGGGGTAAGAGATCAAGGG + Intergenic
1183327934 22:37204543-37204565 GTTGGGGGGTCAGAGGCCAAGGG - Exonic
1184956565 22:47890874-47890896 AGTGAGAGGGAAGAGGCCACAGG - Intergenic
1185379373 22:50500823-50500845 AGGGAGGGGTCAGAGGGCAAAGG + Intergenic
952227896 3:31397979-31398001 TGTCAGGGGTTGGGGGCCAAGGG - Intergenic
952990906 3:38829823-38829845 AGTGAGGGCTTGCAGGTCAAGGG - Intergenic
953009510 3:39011285-39011307 AGTGAGGGCTTAAAGGCCATAGG + Intergenic
953788997 3:45932015-45932037 AATGTGAGGTTAGGGGCCAAGGG + Intronic
956611632 3:71129656-71129678 AGGGAGGGGAGAGAGGCAAAAGG + Intronic
957038888 3:75320938-75320960 AGACAGGAGTTAGAGGCCACAGG - Intergenic
958020056 3:87983665-87983687 AGATTGGGGTCAGAGGCCAAGGG - Intergenic
960836421 3:121911289-121911311 AGTGAGCGGGTAGAGGCAAAGGG + Intronic
961087046 3:124077101-124077123 AGACAGGAGTTAGAGGCCACAGG - Intergenic
961243845 3:125434917-125434939 GGTCAGGGGTTAGAGGTCAGGGG - Intergenic
961427611 3:126860301-126860323 AGTGAGGGATCTGAGCCCAAGGG + Intronic
962363064 3:134757691-134757713 AGTGAGGGGCTAGGGGCCCTTGG + Intronic
962912341 3:139864322-139864344 AGTGGAGGATTAGAGGACAAAGG + Intergenic
963297595 3:143563013-143563035 AGTGGTGGGTAAGAGCCCAAAGG + Intronic
971898147 4:32623161-32623183 AATCAGGGGTGAGAGGCCATGGG + Intergenic
972887712 4:43512861-43512883 TGTCAGGGGTTGGAGGGCAAGGG - Intergenic
973567570 4:52203630-52203652 AGTGTGGTGGTAGAGGCCAGAGG - Intergenic
974359897 4:60864008-60864030 AGTTAGGGGTTAGAAGGTAAAGG + Intergenic
975761624 4:77625705-77625727 AGTGCTGGGGTAGAGCCCAAAGG - Intergenic
977426099 4:96868850-96868872 TGTCAGGGGGTAGAGGGCAAGGG + Intergenic
980531015 4:134054526-134054548 AATGAGGTGATAGGGGCCAAAGG - Intergenic
982557564 4:156887747-156887769 AGTGAGGGGTTATAGGCCTGTGG - Intronic
985683918 5:1271790-1271812 AGTGCTGGGTCTGAGGCCAAAGG - Intronic
986565876 5:9113394-9113416 AGTAAGGGTTTAGAGGAAAATGG + Intronic
988962812 5:36386461-36386483 AGTGAAGGGTTGGAAGCTAAAGG - Intergenic
989739487 5:44753470-44753492 AGAGAGGGGAGAGGGGCCAAAGG + Intergenic
989835616 5:45985751-45985773 TGTGAGGGAATTGAGGCCAATGG + Intergenic
989842324 5:46094075-46094097 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
989842358 5:46094754-46094776 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
990516563 5:56535840-56535862 AGTGAGAGGTCAGCGGCCTAGGG + Intronic
992192963 5:74312233-74312255 AGTGAGGGGACTGTGGCCAAGGG + Intergenic
992762815 5:79966120-79966142 AGTGTGGGGTTAGAAGCAATGGG + Intergenic
994193574 5:96897012-96897034 AGTGTGGTGTTAGAGGAAAAAGG - Intronic
995677749 5:114682204-114682226 TGTTGGGGATTAGAGGCCAACGG + Intergenic
995844029 5:116473904-116473926 AGAGTGGGGTTAAAGGTCAAAGG + Intronic
996242978 5:121225685-121225707 TGTCAGGGGTTAGGGGCCAAGGG + Intergenic
996776305 5:127136206-127136228 AGGGAGTGGTTTGAGACCAAAGG + Intergenic
1000312184 5:160055723-160055745 GGTGAGGGGTTAGAGGCCAGAGG + Intronic
1002063155 5:176638486-176638508 AGTGATGAGTTAGAGGGCATGGG + Intronic
1002438898 5:179253771-179253793 AGTGAGGAGCCTGAGGCCAAAGG - Intronic
1003600950 6:7516899-7516921 AGTGACGGGTTACAGTCCAGTGG + Intergenic
1004291163 6:14368773-14368795 AGTGAGGATTTACAGGTCAAAGG + Intergenic
1007835631 6:44671684-44671706 GGTGAGGGGTGAGAGAGCAAGGG - Intergenic
1009260957 6:61487043-61487065 TGTGAGGTCTTTGAGGCCAATGG - Intergenic
1011389491 6:86836404-86836426 AGTGAGGGCTTACAGGTCATAGG - Intergenic
1011498390 6:87961467-87961489 AGTGACGGGTTAGAGGGGAATGG - Intergenic
1013188918 6:107785505-107785527 ATAGAGGGGTGAGTGGCCAATGG + Intronic
1014786900 6:125630012-125630034 AGTGAGGAATTAGAAGTCAAAGG + Intergenic
1018295845 6:162342811-162342833 CGTTAGGGATTAGAAGCCAAAGG - Intronic
1018733120 6:166668295-166668317 ACTGAGGGGTGAGGTGCCAAGGG - Intronic
1018948532 6:168363940-168363962 GGTGAGGGGTGAGGGGCAAAGGG - Intergenic
1019397307 7:828481-828503 AGTCAGGAGTTCGAGGCCAGCGG - Intronic
1020396095 7:7720359-7720381 AGTGATGGGGAAGAGGCCCAGGG - Intronic
1020430888 7:8115013-8115035 AGTGAGGGGATAGAGGCAATGGG + Intronic
1023822088 7:43986121-43986143 AGGGAGGGGTTAATGCCCAAGGG + Intergenic
1023870542 7:44261009-44261031 AGAGAGGGGTGAGAGGGAAAGGG - Intronic
1025308448 7:57892134-57892156 TTGGAGCGGTTAGAGGCCAACGG - Intergenic
1025519313 7:61701462-61701484 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1025519408 7:61703352-61703374 TGTGAGCAGTTAGAGGCCTATGG + Intergenic
1025519871 7:61712410-61712432 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1025520795 7:61726811-61726833 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025521425 7:61735916-61735938 TGTGAGCGGTTTGAGGCCTATGG - Intergenic
1025522323 7:61752282-61752304 TGTGAGTGGTTTGAGGCCGATGG - Intergenic
1025522341 7:61752625-61752647 TGTGAGTGCTTTGAGGCCAATGG - Intergenic
1025543638 7:62130110-62130132 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1025543733 7:62132004-62132026 TGTGAGCAGTTAGAGGCCTATGG + Intergenic
1025544195 7:62141062-62141084 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1025545152 7:62156372-62156394 TGTGAGGGGTTTGAGGCCTCTGG - Intergenic
1025546006 7:62170117-62170139 TGTGAGCGGTTTGAGGCCGATGG - Intergenic
1025546023 7:62170460-62170482 TGTGAGTGCTTTGAGGCCAATGG - Intergenic
1025741543 7:64201585-64201607 ACTGAGAGGTAAGATGCCAATGG - Intronic
1027244241 7:76355731-76355753 AATGAGGGGTGGGAGGGCAAAGG - Intronic
1028014287 7:85687257-85687279 ATTCTGGGGTTAGAGGGCAATGG - Intergenic
1029362791 7:100099567-100099589 AGTGAGTGGTTAGAGAACAATGG - Exonic
1029637222 7:101793127-101793149 AGTGAAGAGTTAAAGGTCAAGGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029750352 7:102539535-102539557 AGGGAGGGGTTAATGCCCAAGGG + Intronic
1029768304 7:102638643-102638665 AGGGAGGGGTTAATGCCCAAGGG + Intronic
1034534952 7:151720789-151720811 ATTGAGGGGAGAGAGGGCAATGG + Intronic
1035313663 7:157984868-157984890 AGTGAGGGGCAGGAGGCCAGTGG - Intronic
1036155489 8:6338357-6338379 AGTGAGGAGTTAGTGTTCAAAGG + Intergenic
1036794875 8:11748595-11748617 AGTGTGAGGTGAGAGGCCTAGGG + Intronic
1037691467 8:21184703-21184725 AGTGAGGGGTTAGGATCCAAGGG + Intergenic
1044769751 8:95618614-95618636 TGTGAGAGGATGGAGGCCAAAGG + Intergenic
1048453063 8:134551116-134551138 AGTGAGGGGAAAAAGGACAAAGG + Intronic
1049043204 8:140128457-140128479 AATGAGCGGCTAAAGGCCAAGGG + Intronic
1049431283 8:142566475-142566497 GGTGAGCAGTTAGAGGTCAAAGG - Intergenic
1049504879 8:142991003-142991025 TGTGGGTGGTTAGAGGCCATGGG - Intergenic
1051800296 9:20925076-20925098 AGGGAAGGGAAAGAGGCCAAGGG + Intronic
1054363809 9:64209099-64209121 TGTGAGGTCTTTGAGGCCAATGG - Intergenic
1054903924 9:70398148-70398170 AGTGAGAGGTCAGAAGCAAATGG - Intronic
1054920240 9:70536266-70536288 AGTGAGGAGAATGAGGCCAAAGG - Exonic
1056377991 9:86033094-86033116 AGTGAGGGTTGAGAAGCCCAAGG - Intronic
1057518469 9:95741035-95741057 AGTGTGAGGTTAGCAGCCAAGGG - Intergenic
1059722695 9:116976686-116976708 AGTGAAGGGTGAGTGGCAAAGGG - Exonic
1059875008 9:118625085-118625107 TGTCAGGGGTTAGGGGGCAAGGG - Intergenic
1061251422 9:129428668-129428690 TGCCAGGGGCTAGAGGCCAATGG - Intergenic
1062540011 9:137037401-137037423 AGTGAGAGGTGAGAGGCAAGGGG + Exonic
1203382991 Un_KI270435v1:78639-78661 TCTGAGGGGTTTGAGGCCTATGG - Intergenic
1203383172 Un_KI270435v1:82223-82245 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1203358404 Un_KI270442v1:186810-186832 TGTGAGGGCTTTGAGGCCTATGG + Intergenic
1203360181 Un_KI270442v1:213753-213775 TGTGAGTGCTTGGAGGCCAATGG - Intergenic
1203402796 Un_KI270519v1:129875-129897 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1203682982 Un_KI270757v1:2511-2533 TGTGAGTGGTTTGAGGCCTATGG - Intergenic
1187309276 X:18125566-18125588 AGTGAAGGGTTGGAGGACATTGG - Intergenic
1189659752 X:43285091-43285113 AGGGAGTAGTCAGAGGCCAACGG + Intergenic
1190708916 X:53051248-53051270 AGTGTGGGGTCGGTGGCCAAGGG + Intronic
1191269586 X:58446175-58446197 TGTGAGTGGTTTGAGGCCTATGG + Intergenic
1191269897 X:58451810-58451832 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191270532 X:58461109-58461131 TGTGAGCGGTTTGAGGCCAATGG - Intergenic
1191270769 X:58465322-58465344 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191271040 X:58469792-58469814 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191271088 X:58470655-58470677 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191271286 X:58474596-58474618 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191567024 X:62552302-62552324 TTTGAGAGGTTTGAGGCCAATGG + Intergenic
1191574353 X:62680082-62680104 TGTGAGCGGTTGGAGGCCTATGG + Intergenic
1191574531 X:62683346-62683368 TGTGAGCGGTTTGAGGCCTATGG + Intergenic
1191574791 X:62688487-62688509 TGTGAGCGGTTGGAGGCCTATGG + Intergenic
1191575048 X:62693286-62693308 TGTGAGGGGTTTGATGCCAATGG - Intergenic
1193880316 X:86912992-86913014 AGTGAGGGCTTACAGGTCATAGG - Intergenic
1194051289 X:89072139-89072161 AGTGAGGGTTTATAGGTCATAGG + Intergenic
1194431975 X:93819524-93819546 AGTGTGCGGTTGGGGGCCAATGG + Intergenic
1195347915 X:103969384-103969406 TGTCAGGGGTTAGGGGCAAAGGG - Intergenic
1195359527 X:104069457-104069479 TGTCAGGGGTTAGGGGCAAAGGG + Intergenic
1195618369 X:106930363-106930385 AGTGAGGGGTCATACACCAAAGG + Exonic
1196810505 X:119625453-119625475 AATGAAGGGTTAGAGGTCAAAGG + Intronic
1201062865 Y:10063551-10063573 ATTAAGGGCTTTGAGGCCAAAGG - Intergenic