ID: 1162304574

View in Genome Browser
Species Human (GRCh38)
Location 19:9864090-9864112
Sequence TTTTCTGCTGGCCCCATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162304574_1162304578 10 Left 1162304574 19:9864090-9864112 CCTTGCATGGGGCCAGCAGAAAA 0: 1
1: 0
2: 2
3: 13
4: 157
Right 1162304578 19:9864123-9864145 AATCCTCAGAGATGACCTACAGG 0: 1
1: 0
2: 0
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162304574 Original CRISPR TTTTCTGCTGGCCCCATGCA AGG (reversed) Intronic
901184520 1:7364244-7364266 TGTTGTTCTGGCACCATGCATGG - Intronic
901881304 1:12195389-12195411 GGTCCTGCTGGCACCATGCAAGG - Intronic
906568660 1:46818197-46818219 TTCTCTGCTGGGCCCAGGTATGG + Exonic
906608392 1:47186491-47186513 TTGAGTGCTAGCCCCATGCAGGG - Intronic
906683760 1:47749310-47749332 TTTTCTGGTGTTCTCATGCAGGG - Intergenic
907715343 1:56921479-56921501 TCTTGTGCAGGCCCCATGCTGGG + Intergenic
908609867 1:65845879-65845901 TTTTCTCCAGTCCCTATGCAGGG + Intronic
911060600 1:93744679-93744701 GTTTCTGCTGGCCTCAGGCTTGG - Intronic
911219760 1:95234274-95234296 TTTTCTGCAGGCCCCACGAGTGG + Exonic
912842819 1:113053650-113053672 TTCTCTGCTTTCCCCAAGCAGGG - Intergenic
914972703 1:152325264-152325286 TTTATAGCAGGCCCCATGCAGGG + Intergenic
918096651 1:181341618-181341640 TTTCATGTTGGGCCCATGCAGGG - Intergenic
918235893 1:182580571-182580593 TTATGTGCTAGGCCCATGCAAGG - Intronic
919858478 1:201721735-201721757 TTTTCTGCTGGCCCAGTGCTGGG - Intronic
920685198 1:208103937-208103959 TCTTCTGCTGGGGCCCTGCAGGG + Intronic
923104044 1:230840731-230840753 TTTTCTGCTGGCCGGCTGCTTGG - Intronic
924282917 1:242456114-242456136 TTTTCTCCTGACCCCAACCAAGG + Intronic
924306208 1:242691569-242691591 TATTCTGCTGGCCTCAGGCTTGG - Intergenic
1063086952 10:2828553-2828575 CTTCCTCCTTGCCCCATGCATGG + Intergenic
1063649553 10:7919272-7919294 TTTTCTGCAGGCCCCATCTGGGG + Intronic
1066119673 10:32273058-32273080 TTTTCTGCTGGTTAGATGCAAGG + Exonic
1067192478 10:44082972-44082994 ATCTCTGCTGGCCCCATGCCTGG + Intergenic
1067751077 10:48971659-48971681 TTGTCTCCTGGTGCCATGCAGGG + Intronic
1067807763 10:49404852-49404874 TTTTCTTTTGCCCCCATGTAAGG - Intergenic
1067957850 10:50812887-50812909 GTTTCTGCTAGCCCCACCCAGGG - Intronic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1070608373 10:77915580-77915602 TTTTCTGCAGGCCCCTTGAGAGG - Intronic
1071418029 10:85459228-85459250 TTTTCTTCTGTCCCCATACCAGG - Intergenic
1071447761 10:85764540-85764562 TATTGTGCTGGACCCCTGCAGGG - Intronic
1074530690 10:114296937-114296959 ATTTCTGCTGGCCCCAAGGGAGG + Intronic
1079986791 11:27208261-27208283 TTCTGTCCTGGCCCCATGCTTGG - Intergenic
1080788196 11:35495059-35495081 TTTTCTGATGGCCACATGCCTGG - Intronic
1084731361 11:71075683-71075705 TTTTGTGCTGCCCCCTTGGAAGG - Intronic
1084758655 11:71254285-71254307 TTTTCGGCTATCTCCATGCAAGG + Intergenic
1084833506 11:71787162-71787184 TCTTATCCTGCCCCCATGCAAGG + Intergenic
1085412273 11:76298298-76298320 TCCTCTGATGGCCCCATCCATGG - Intergenic
1092271925 12:7030513-7030535 TTAGATGCTGGCTCCATGCAAGG + Intronic
1093796446 12:23318685-23318707 TTTGCTGTAGGCTCCATGCAGGG + Intergenic
1100963606 12:99989328-99989350 TTTTCAGCTGGCCAGGTGCAGGG - Intergenic
1101006390 12:100405169-100405191 TTGACTGCTGGTCCCAGGCAGGG + Intronic
1102483656 12:113241552-113241574 CTTTCTGCTGACCTCTTGCAGGG + Intronic
1103781143 12:123399456-123399478 TTTTCTGCTGGGACCAAACACGG - Intronic
1104896821 12:132168796-132168818 CTCCCTGCTGGCCCCATGAAAGG - Intergenic
1105330483 13:19411198-19411220 TCTTCTGCTGGTCTCATGGAAGG - Intergenic
1105918562 13:24939984-24940006 TCTTCTGCTGGTCTCATGGAAGG - Intergenic
1112790826 13:103000678-103000700 GTTTCTGCTGGCCCCATCTTAGG + Intergenic
1114711241 14:24780671-24780693 ATTTCTGCTGGTTCCATGCGTGG + Intergenic
1118051912 14:62038387-62038409 GTTTCTCCAGGGCCCATGCATGG - Intronic
1119292957 14:73510340-73510362 TATTCTTCTGGTGCCATGCATGG - Intronic
1120825333 14:88949893-88949915 TTTTCTGCTTGTCCCAACCATGG + Intergenic
1121639783 14:95477553-95477575 GCTTCTTCTGGCCCCGTGCAGGG - Intergenic
1122805179 14:104252853-104252875 CTTGCTGCTGGCCCCAGGCATGG - Intergenic
1122909386 14:104819649-104819671 GTTTCTGCAGGCCCCACCCAGGG - Intergenic
1123104262 14:105830770-105830792 TTCTCTGCTTGCCCAATGCCTGG - Intergenic
1124653552 15:31489612-31489634 TCTTCTGCAGGCACCATGGAAGG - Intronic
1128609534 15:69062927-69062949 TTCTCTGCTGCTCCCCTGCAAGG + Intergenic
1130210117 15:81914841-81914863 TTTTCTTCTGGCCCCCAGCCAGG + Intergenic
1132255406 15:100372811-100372833 CTCTCTGCTGGCACCGTGCAGGG + Intergenic
1132515328 16:363345-363367 CCCTCTGCTGGCCCCAGGCACGG - Intergenic
1132980641 16:2737242-2737264 TTTTCTCCTGTACCCATCCATGG - Intergenic
1133615791 16:7475687-7475709 TTTGCTGCTTGCCACATGAATGG + Intronic
1135960800 16:26993183-26993205 CTTTATGCTGGCCCGAGGCAAGG - Intergenic
1137765917 16:50977492-50977514 CTTGCTGCTGGCCACACGCAGGG + Intergenic
1138236388 16:55386825-55386847 TTTTCTGCTGACTTCCTGCATGG - Intergenic
1139292466 16:65871094-65871116 TTTTCTGCTCGTCACATGCATGG + Intergenic
1139325950 16:66152657-66152679 CCCTCTGCTGGCACCATGCAGGG - Intergenic
1145311957 17:21705791-21705813 TTTTCTGAAGGTCCCCTGCATGG + Intergenic
1150566835 17:66349535-66349557 TTTTCTTCTGGCCTTTTGCATGG + Intronic
1150602123 17:66660214-66660236 TCTTCTGCTCCCCCCATCCAAGG + Intronic
1151964422 17:77423931-77423953 TTCCCTGCTGGCCCCAGGCAGGG - Intronic
1152538679 17:80964078-80964100 TCCTCTGCAGGGCCCATGCATGG - Intronic
1153286084 18:3455745-3455767 TTTTCTGCTAACACCATGCATGG - Intronic
1153608030 18:6854652-6854674 GCTCCTGCTGGCCCCATGGAAGG - Intronic
1153756001 18:8283840-8283862 CTTTCTCCTGGCCTCAAGCAAGG + Intronic
1154111678 18:11574562-11574584 TTTACTGGTGGCCCCAGCCACGG + Intergenic
1155368433 18:25072650-25072672 TTTTCTGCTGGCTTCTTGCATGG - Intronic
1157958391 18:52124997-52125019 TTTTCTTCTGGCGACATGTATGG - Intergenic
1160593088 18:79955030-79955052 TTCTCTGATGGGCCCATGAAAGG - Intergenic
1161950164 19:7463473-7463495 TTTCCTGCTGGCCCTGGGCAGGG + Intronic
1162304574 19:9864090-9864112 TTTTCTGCTGGCCCCATGCAAGG - Intronic
1163432464 19:17276483-17276505 TTTTCTGCTGGCTGCATACCCGG - Exonic
1163561421 19:18021592-18021614 TTTCCTCCTGGCCCCTTGCCCGG - Intergenic
1164315927 19:24087813-24087835 TTTTCTTCAGGCCCCTTCCATGG - Intronic
1167296296 19:48652145-48652167 TTTTCTGCAGTGCCCATGGAGGG + Intergenic
925375111 2:3378603-3378625 ATTTCTGCTGGCCCAAGGCCAGG - Intergenic
927234643 2:20859655-20859677 TTTTCTGCAGGCTCTATCCAAGG - Intergenic
927250706 2:20992887-20992909 ATTGTGGCTGGCCCCATGCAAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
931092520 2:58901226-58901248 TTTTCTGCAAACCCCAGGCATGG - Intergenic
931853895 2:66281567-66281589 TCCTCTGTTGGCCCCATACATGG + Intergenic
931963829 2:67511166-67511188 TTGTCTGCTTGCCCCACACAAGG + Intergenic
932422787 2:71611467-71611489 TGTTCCGCAGGCCCCATGCCAGG - Exonic
935223656 2:101035497-101035519 TTTTCTGCTGGACCCATTCAGGG - Intronic
935769622 2:106404914-106404936 TTTTATTCTGGCAGCATGCATGG + Intronic
935910471 2:107891014-107891036 TTTTATTCTGGCAGCATGCATGG - Intergenic
935968595 2:108507855-108507877 TTTTATTCTGGCAGCATGCATGG - Exonic
936132263 2:109856157-109856179 TTTTATTCTGGCAGCATGCATGG - Exonic
936212434 2:110515328-110515350 TTTTATTCTGGCAGCATGCATGG + Exonic
936421574 2:112369895-112369917 TTTTATTCTGGCAGCATGCATGG + Intergenic
937770012 2:125709532-125709554 TTTTCTGCTGGCCCCTTGAAGGG - Intergenic
941998413 2:171623237-171623259 TTTGCAGCTGGCACCATGGAAGG - Intergenic
944583183 2:201150655-201150677 TTATCTGCTAGCCAGATGCAAGG - Intronic
948226075 2:236310212-236310234 TTTTCTCCTGGGCCCAGGAAAGG - Intergenic
948374257 2:237510851-237510873 TCTTCAGCTAGCCCCATGGAAGG - Intronic
948575389 2:238946645-238946667 CTTTCTCCTGGGCCCATGCATGG - Intergenic
1171351705 20:24507567-24507589 TCTTCTGCAGGCCACATTCACGG - Intronic
1171458364 20:25284413-25284435 TTTTCTGTGTGCCCCATGCCAGG + Intronic
1171984968 20:31653803-31653825 TTTCCTGCCTGCCCCATGCTTGG - Intergenic
1174117788 20:48239240-48239262 TTCTCTGCCTGCCCCATGCCAGG - Intergenic
1175822760 20:61919355-61919377 TTCACTGCCGGCCCCAAGCATGG + Intronic
1176661101 21:9635467-9635489 TCATCTGCTGGCCCCAGGCCGGG + Intergenic
1180006927 21:45027139-45027161 TATTGTGCAGGCCCCATCCATGG - Intergenic
1184130889 22:42515755-42515777 GTCTCTGCTGGCCACCTGCAGGG - Intronic
1184141065 22:42577585-42577607 GTCTCTGCTGGCCACCTGCAGGG - Intergenic
953533247 3:43756873-43756895 CTTTCTCCTGTCCCCATGAAAGG + Intergenic
959295623 3:104531035-104531057 TGGTCTGCTGGCCCCTTCCAGGG + Intergenic
961152391 3:124650208-124650230 TTTTCCCCTGTCCCCATGGATGG - Intronic
961345632 3:126261420-126261442 TTTTCTGCTGGGGCCTTGCCTGG - Intergenic
961464109 3:127071138-127071160 CTTTCTGCTGGCTGCAAGCAAGG + Intergenic
962536090 3:136329802-136329824 TATACTGCTGGCCCCAGGGATGG + Intronic
962991031 3:140577767-140577789 AATTCTGCTGCCCTCATGCAGGG - Intergenic
963007283 3:140737965-140737987 TGTTCTGGAGGCCCCAAGCAGGG + Intergenic
963365816 3:144332885-144332907 TTTTCTGCTGGTCTCCTTCATGG + Intergenic
964499771 3:157335876-157335898 TTGTTTGCTGGACTCATGCAGGG + Intronic
966284565 3:178278816-178278838 ATTTCTCCTTTCCCCATGCAAGG - Intergenic
967060347 3:185866650-185866672 TTTTCAGCCTGCCCCAAGCAAGG + Intergenic
967936877 3:194735898-194735920 TTTTGTGCTTGGCCCATGGAAGG + Intergenic
967972073 3:195006379-195006401 GTTTCTGCCAGCCCCAAGCATGG + Intergenic
968694493 4:2016433-2016455 TTATCTGCTTGCACCATGCCGGG + Intronic
969594592 4:8141941-8141963 TTTTCTGGTGGGCTCCTGCATGG - Intronic
969866111 4:10078038-10078060 TGCTCTGCTGGGCCCATGCCAGG + Intronic
973019711 4:45187548-45187570 TTTTCTCCTGGTACCATGGATGG + Intergenic
977704988 4:100061128-100061150 TTTTCTGCTTGCCCTTTGCTTGG - Intergenic
980569020 4:134586225-134586247 CTTGCTGCTGGGGCCATGCATGG - Intergenic
985414296 4:189721069-189721091 TCATCTGCTGGCCCCAGGCCGGG - Intergenic
986641128 5:9873340-9873362 ATTTCTCCTGGCCCCACACAGGG + Intergenic
989602891 5:43216193-43216215 TTTTCTGAAGACCCCAGGCATGG + Intronic
992045011 5:72879136-72879158 TTTTCTGCTGGCTAAAAGCAGGG - Intronic
992312831 5:75519702-75519724 TTTTCTGGTTTCCCCTTGCATGG + Intronic
992521534 5:77556662-77556684 TTTTGTGGTTGCCCCATGAAAGG + Intronic
993228801 5:85204774-85204796 TTTCCTGCTGGCCTCTTCCAGGG - Intergenic
999116319 5:149166955-149166977 TCTTCTGCTGGCCCACTGAATGG - Intronic
1001710187 5:173772169-173772191 TTTTCTGCTGCCCCAAGCCAAGG - Intergenic
1003831568 6:10017556-10017578 TTCTCTTCTGGCCACCTGCAGGG + Intronic
1006449610 6:34098578-34098600 GCTTGTGCTGGCCCCGTGCAGGG - Intronic
1007478231 6:42133406-42133428 TTTTATGCTTGCCACATGCATGG + Intronic
1011883251 6:92058592-92058614 TTTTCTGCAGCCCCCATTCCTGG - Intergenic
1013918294 6:115367741-115367763 GTTTCTTCTTGCCCCATCCATGG - Intergenic
1021576921 7:22113345-22113367 TTCCCTGCTGGCCCTCTGCAGGG - Intergenic
1024619720 7:51147036-51147058 CCTTCTGCTGTCCCTATGCAGGG - Intronic
1025610765 7:63073853-63073875 TCTTCTGCTGTCCCCATCCTTGG + Intergenic
1029667778 7:102007036-102007058 TTTGCTGCTGGCCTCATCCAAGG + Intronic
1030135342 7:106241570-106241592 TTTTCTGCTGCTCTCATTCATGG + Intergenic
1030849820 7:114470144-114470166 TTGTCTCCTGGCTCCCTGCATGG + Intronic
1031843837 7:126780637-126780659 TCTTCTGCTGCCCCCATCAATGG - Intronic
1032433233 7:131879919-131879941 CTTTCTGTTGTCCCCATCCATGG - Intergenic
1032522086 7:132553181-132553203 GTTTCTGCCAGCCCCAGGCATGG + Intronic
1033359309 7:140626793-140626815 TCTTGTGCTGGCCCCAAGCAAGG - Intronic
1038497988 8:28019468-28019490 TTTTCTGCTGGCTTCATTCCAGG + Intergenic
1038670700 8:29580762-29580784 TCTTCTGCTGTCCCCATGCCAGG + Intergenic
1040866072 8:52050258-52050280 TTTTCTGCTGCTCCCAGGCTTGG - Intergenic
1041139851 8:54805735-54805757 TTTTCTGCAGGTGCCATGGAAGG + Intergenic
1042062844 8:64840069-64840091 TTTTCTGCTTACCCCACACAAGG - Intergenic
1050279732 9:4037911-4037933 TTTTCAGCTGCCCACATTCAGGG + Intronic
1053243719 9:36517647-36517669 TTCTCCTCTGGCCCCATGCTAGG + Intergenic
1056450463 9:86711707-86711729 TTTTCTTCTTGCCCCATACCTGG - Intergenic
1057139190 9:92716598-92716620 TTATCTGCTGGGCCCATGGTGGG + Intronic
1057886536 9:98834029-98834051 TTCTCAGTTGGCCCCATGCTTGG + Intronic
1058132898 9:101273482-101273504 TGTTCTGCTGGACCACTGCAAGG + Intronic
1203638669 Un_KI270750v1:137311-137333 TCATCTGCTGGCCCCAGGCCGGG + Intergenic
1200035287 X:153323248-153323270 TCTTATGCTTGCCCCTTGCATGG + Intergenic
1200052923 X:153444377-153444399 TCTTGTGCTGGCCCCTGGCATGG + Intergenic
1201362989 Y:13173907-13173929 TTTTCTCCTAGTCCCATACAAGG + Intergenic