ID: 1162306905

View in Genome Browser
Species Human (GRCh38)
Location 19:9880370-9880392
Sequence GAGCAGAAGCTTTATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162306905_1162306910 28 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG 0: 1
1: 0
2: 3
3: 10
4: 181
1162306905_1162306909 5 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1162306905_1162306908 -5 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162306905 Original CRISPR GAGCAGAAGCTTTATGAGGT TGG (reversed) Intronic
No off target data available for this crispr