ID: 1162306908

View in Genome Browser
Species Human (GRCh38)
Location 19:9880388-9880410
Sequence TGCTCTAGTAGGAAGACGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162306904_1162306908 -4 Left 1162306904 19:9880369-9880391 CCCAACCTCATAAAGCTTCTGCT 0: 1
1: 0
2: 1
3: 23
4: 202
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69
1162306905_1162306908 -5 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69
1162306906_1162306908 -9 Left 1162306906 19:9880374-9880396 CCTCATAAAGCTTCTGCTCTAGT 0: 1
1: 0
2: 4
3: 63
4: 299
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69
1162306902_1162306908 16 Left 1162306902 19:9880349-9880371 CCAGGAGACGCGCAGACATCCCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69
1162306903_1162306908 -3 Left 1162306903 19:9880368-9880390 CCCCAACCTCATAAAGCTTCTGC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162306908 Original CRISPR TGCTCTAGTAGGAAGACGCA TGG Intronic
905306354 1:37021439-37021461 GGATCCAGAAGGAAGACGCAAGG + Intronic
912719332 1:112006517-112006539 TGCTCTAGAAGGGAGACTCTAGG - Intergenic
917713730 1:177712606-177712628 TGCTCCAGAAGCAAGAGGCAGGG + Intergenic
1066660755 10:37736750-37736772 TGCTCTAAAAGGAAGAGGAAGGG - Intergenic
1066993725 10:42542579-42542601 TGCAATAGTATGAAGAGGCATGG + Intergenic
1067789014 10:49273438-49273460 AGCTTTAGCAGGAAGAAGCATGG + Intergenic
1068110876 10:52679315-52679337 TGCTGTGGGAGGAAGACGAAGGG + Intergenic
1069072384 10:64002628-64002650 TGTTCTATTAGAAAGACACATGG + Intergenic
1069439459 10:68415005-68415027 TGCCCTAGTATGAAAAGGCAAGG + Exonic
1069625439 10:69865079-69865101 TGCTCTGTTAGGAAGACCCCAGG + Intronic
1071284597 10:84132861-84132883 TCCTCTAGTAGGCATACACATGG - Intergenic
1076505104 10:130967014-130967036 TGCTCGAGGAGGGAGACCCAGGG - Intergenic
1078017250 11:7625519-7625541 TGGTCAGGTAGGAAGATGCAGGG + Intronic
1081710583 11:45213055-45213077 TGCACTAGGAGGAAGAGTCATGG + Intronic
1091996560 12:4998332-4998354 TGCTCTAGAAGGAAGGAGTAGGG + Intergenic
1099366508 12:81772000-81772022 TACTCTATTAGAGAGACGCAGGG - Intergenic
1104475709 12:129068867-129068889 TGCTCTGGCAGGAAGACGGATGG - Intergenic
1113582849 13:111440893-111440915 GGCTATAGGAGGAAGAGGCAAGG - Intergenic
1115716978 14:36116745-36116767 TGCTTTAGTGTGAAGACGCCAGG + Intergenic
1119130555 14:72168729-72168751 TGCTCTAGAAGGGAGAAGTACGG + Intronic
1122588454 14:102827261-102827283 TGCTCTAGGAGGAAGAGTCATGG - Intronic
1125134490 15:36326039-36326061 TGCTCTACTAGGAAGACAACAGG + Intergenic
1132809426 16:1790484-1790506 TGCACTTGCTGGAAGACGCAAGG - Exonic
1144428729 17:15170881-15170903 TCCTGTAGTAGGGAGAAGCAAGG - Intergenic
1148742207 17:49899199-49899221 TGCTCGGGGAGGAAGACTCAAGG - Intergenic
1149072880 17:52563948-52563970 TTCTGTAATAGGAAGATGCATGG - Intergenic
1154163277 18:11995599-11995621 TGCTCTGCTGGGGAGACGCATGG + Intronic
1154330652 18:13426558-13426580 AGCTGCAGTAGGAAGAGGCACGG - Intronic
1154348984 18:13567276-13567298 TGTTAGATTAGGAAGACGCAAGG - Intronic
1162306908 19:9880388-9880410 TGCTCTAGTAGGAAGACGCATGG + Intronic
1162405707 19:10472101-10472123 TGCTTGAGTAGGTAGACACAAGG + Intergenic
1166986742 19:46664843-46664865 TGCTCTGGTAGGAAGAGTAATGG + Intergenic
1167278439 19:48552609-48552631 TGCTCTATCAGGGAGACACAGGG - Intronic
930164937 2:48195386-48195408 TGGTGTAATAGGAACACGCAGGG - Intergenic
933292971 2:80457992-80458014 AGCTCTAGAAGGAAGCAGCAAGG - Intronic
936264434 2:110991813-110991835 AGCTCTAGTATGAAGACAAATGG - Intronic
937470803 2:122172397-122172419 TGGTCCAGTAGGAAGGCTCATGG + Intergenic
939935234 2:148283737-148283759 TGCTCTAGTAAGCATAGGCATGG - Intronic
940291486 2:152081614-152081636 TGCTCTTGTAAGAAGAAGAAGGG - Intronic
941251506 2:163170706-163170728 TGCTATAGTAGTGAGACACATGG + Intergenic
943998417 2:194801272-194801294 TGCTCCAGTAGGAAGAGGGGTGG + Intergenic
944745018 2:202646396-202646418 TACTCTAGAAAGAAGACGCAGGG + Intronic
1170922550 20:20692449-20692471 GGCTCTATTAGGAAGAGGGAGGG - Intronic
1172608891 20:36234685-36234707 AGCTCTAGTGGGTAGACGCCAGG + Intergenic
1178872386 21:36387107-36387129 TGCTCTAGAAAGAAGGCGGAGGG + Intronic
1178969554 21:37160085-37160107 TGCTCTAGAAGGAAAACAAAGGG + Intronic
949753095 3:7376887-7376909 TGCACTGGTAGGCAGAGGCATGG - Intronic
952766738 3:36960884-36960906 TGCAATAGTAGTAAGAGGCAGGG + Intergenic
962179738 3:133193439-133193461 TTATCTTGTAGGAAGAAGCATGG + Intronic
970098699 4:12495441-12495463 TGCTCTAGAAGGTAGAAGCAAGG + Intergenic
973365819 4:49208493-49208515 TGCTCTGATTGAAAGACGCAGGG - Intergenic
973394779 4:49583958-49583980 TGCTCTGATTGAAAGACGCAGGG + Intergenic
974563103 4:63547654-63547676 TGCTCTAGTAAGGACATGCATGG + Intergenic
979291668 4:118985170-118985192 TGCTCTAGTAGGATGTAGCAGGG + Intronic
981186665 4:141811547-141811569 TGATCTACTAGGAGGACTCACGG - Intergenic
983193646 4:164781615-164781637 GGATCTAGTGGGAAGAGGCAAGG - Intergenic
988549870 5:32190689-32190711 TGCTCTAGTGGGTAGACCCTAGG - Intergenic
991508595 5:67352046-67352068 TACTCTAGTAGGAAGACATTGGG + Intergenic
991519518 5:67480160-67480182 TGCACTTGTAGGGAGACACAAGG - Intergenic
992979754 5:82156538-82156560 TGCTCTAGGAGGAAGGCCCAAGG - Intronic
1002444146 5:179278838-179278860 TTCTATAGAAGGAAGAGGCAGGG - Intronic
1011198331 6:84805680-84805702 TGCACTAGCAGCAAGATGCAGGG - Intergenic
1013570121 6:111414722-111414744 TGTTCTGCTAGGAAGACGGAAGG - Intronic
1015594709 6:134855533-134855555 GGATCTAGTGGGAAGAGGCAGGG - Intergenic
1018201297 6:161398171-161398193 TGCTCTGTTAGGAAGACCAAGGG - Intronic
1023662227 7:42481557-42481579 GGCTCCAGTAAGAAGACACACGG + Intergenic
1034122285 7:148638670-148638692 TGCTCTAATAGTGAGACCCAGGG - Intergenic
1035920158 8:3667954-3667976 GGCTCTGTTAGAAAGACGCAGGG - Intronic
1037687023 8:21149416-21149438 TGCTGTAGTAGGCAGGAGCAGGG - Intergenic
1038080024 8:24123936-24123958 TGCTTTGGTAGGAAGATCCAGGG + Intergenic
1039213192 8:35238319-35238341 TACTCTAGGAGGAAGACCCTTGG + Intronic
1043483172 8:80673294-80673316 TGCACTAGAAGGAAGAAGCCTGG + Intronic
1043922980 8:86005069-86005091 TGCTCTGGTAGGAGGATGGATGG - Intronic
1048599360 8:135902622-135902644 TGTTCTTATAGGAAGAGGCAAGG - Intergenic
1186432931 X:9520336-9520358 TGGTCTAGTTGGAAGACACAAGG + Intronic
1200276777 X:154740924-154740946 TTCTCTAGTAGGTAGAGGCCAGG - Intronic
1202097265 Y:21264609-21264631 TGCTCTAGAAGGAACAAGCTAGG - Intergenic