ID: 1162306909

View in Genome Browser
Species Human (GRCh38)
Location 19:9880398-9880420
Sequence GGAAGACGCATGGCAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162306903_1162306909 7 Left 1162306903 19:9880368-9880390 CCCCAACCTCATAAAGCTTCTGC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1162306905_1162306909 5 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1162306906_1162306909 1 Left 1162306906 19:9880374-9880396 CCTCATAAAGCTTCTGCTCTAGT 0: 1
1: 0
2: 4
3: 63
4: 299
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1162306902_1162306909 26 Left 1162306902 19:9880349-9880371 CCAGGAGACGCGCAGACATCCCC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1162306904_1162306909 6 Left 1162306904 19:9880369-9880391 CCCAACCTCATAAAGCTTCTGCT 0: 1
1: 0
2: 1
3: 23
4: 202
Right 1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162306909 Original CRISPR GGAAGACGCATGGCAAACAG AGG Intronic
901495179 1:9616977-9616999 GGAAGATGCCTGGGAACCAGGGG - Intergenic
901657852 1:10780861-10780883 GAAAGACACAAGGCAAGCAGTGG - Intronic
905333739 1:37228610-37228632 AGAACAGGCCTGGCAAACAGTGG - Intergenic
905489986 1:38335899-38335921 TGAATACGCATTGCAAACATTGG + Intergenic
912394977 1:109335374-109335396 GGCAGACAGATGGGAAACAGGGG + Intronic
918350876 1:183654317-183654339 GGATGACCCATGGCAAACTGTGG - Intronic
918900622 1:190412024-190412046 GGGAGAAGCATGTCAAACATAGG - Intronic
918996964 1:191773816-191773838 GCAAGACTCATGGCAAACCTGGG + Intergenic
922238645 1:223740238-223740260 GGAACAAGCATTTCAAACAGAGG - Intronic
922647978 1:227310408-227310430 GGAAGAGTAAAGGCAAACAGTGG + Intronic
1063075224 10:2710028-2710050 GGAAGACACATGCCCAAAAGAGG - Intergenic
1067769205 10:49111312-49111334 GGAACACCAATGGCAATCAGAGG + Intronic
1071091805 10:81927754-81927776 GGAATACTCATGGCCAAGAGGGG - Intronic
1072172407 10:92878422-92878444 GGAAGAATCATGGGAAAAAGGGG - Intronic
1074145994 10:110717702-110717724 GGAAGAGGGATGGGAAACTGTGG - Intronic
1076878735 10:133230067-133230089 GGAAGACGCAGAGCAAAGACTGG - Intergenic
1077868093 11:6239623-6239645 GGGAGACGCCTCGCACACAGAGG + Intronic
1079147041 11:17862130-17862152 GGAGAAGGCATGGCAAACTGGGG - Intronic
1082633708 11:55570775-55570797 GGAACAAGCATTTCAAACAGTGG + Intergenic
1082790056 11:57340893-57340915 GGAAGGAGGCTGGCAAACAGGGG + Intronic
1083816552 11:65135544-65135566 GGAAAACGCAAGGCACAAAGTGG - Intergenic
1084033563 11:66494768-66494790 GAAAGACGCATGGCATGCAGTGG + Intronic
1085758735 11:79223702-79223724 GGAAGAGCCATGGAAGACAGTGG - Intronic
1100892167 12:99137735-99137757 AGAAAAAGCATGGCACACAGGGG - Intronic
1102241785 12:111329059-111329081 GGAAGAGACAGAGCAAACAGAGG - Intronic
1104430862 12:128714857-128714879 GGAAGAAGCCAGGCAGACAGGGG + Intergenic
1104992279 12:132632589-132632611 GGACCACCCATGGCACACAGAGG + Intronic
1107964460 13:45586766-45586788 GGAAGACGAATGAAAAACAGGGG + Intronic
1108937652 13:55904032-55904054 GGAAGGTGCTCGGCAAACAGAGG + Intergenic
1110004714 13:70251406-70251428 GGAAGAATCATGGGAAAGAGGGG + Intergenic
1113172956 13:107527043-107527065 GAAAGACACATTGCAAACATTGG - Intronic
1116640452 14:47455519-47455541 GGAAGAAGCATGTAAAAGAGTGG + Intronic
1119762584 14:77162087-77162109 GGAAGAGGCTTGGCAAAGACCGG - Intronic
1120516473 14:85476791-85476813 GGAAAATGCATGGGAAAAAGTGG + Intergenic
1121323537 14:93006717-93006739 GGAAGACCCATGCAAAACAATGG + Intronic
1121983515 14:98476241-98476263 GGAAGACTGGTGGCAAAGAGGGG + Intergenic
1124552942 15:30698719-30698741 GCAAGACACATGGCATACCGTGG + Intronic
1124678301 15:31706951-31706973 GCAAGACACATGGCATACCGTGG - Intronic
1124930819 15:34117758-34117780 GGAAGCCTCAAGGGAAACAGAGG + Intergenic
1125483033 15:40093394-40093416 AGAAGAGGCCTGGCAGACAGAGG + Intronic
1127908887 15:63399241-63399263 GGTAAACGTATGGTAAACAGAGG - Intergenic
1128300221 15:66562006-66562028 GGAGGGCGCATGGCAAAGAGGGG - Intronic
1130024844 15:80262159-80262181 GGAAGAGGAATGGGAAGCAGAGG + Intergenic
1131889973 15:96962525-96962547 GCAAGAAGCATGGGAAAGAGTGG - Intergenic
1138108529 16:54305114-54305136 GGAAGGGGCAGGGGAAACAGAGG - Intergenic
1138152262 16:54669735-54669757 GCAAGAAGCATGGCATACAGGGG - Intergenic
1138657168 16:58498213-58498235 GGAAGAGGCTTGGAAAACTGAGG - Intronic
1141329669 16:83098739-83098761 AGAAGACACATGGCACACAGAGG - Intronic
1144573184 17:16413338-16413360 AGAAGAGGCATGGCATACTGGGG + Intergenic
1145956142 17:28856228-28856250 GGAAGAAGCATGAGACACAGTGG - Intronic
1159909474 18:74131665-74131687 GGAAGACACAGGGAAAACTGAGG + Intronic
1162306909 19:9880398-9880420 GGAAGACGCATGGCAAACAGAGG + Intronic
1167724703 19:51202043-51202065 GGAAGAGTCATGGGGAACAGAGG - Intergenic
1167758055 19:51425832-51425854 GGAAGAGGTGTGGAAAACAGAGG + Intergenic
925759330 2:7169212-7169234 GGAAGACGTCTTGCATACAGTGG + Intergenic
925785059 2:7423908-7423930 GGAAGATGGATGTCAAACTGGGG - Intergenic
928375232 2:30768394-30768416 GGAAGATGCATAGCAAAGACAGG + Intronic
931377241 2:61718473-61718495 AGAGGAAGCATTGCAAACAGAGG - Intergenic
933553619 2:83806177-83806199 GGAAGAAGCATGGAGAAAAGTGG + Intergenic
933984432 2:87578843-87578865 GGAAAACCAATGGCAAACACTGG - Intergenic
936309422 2:111371956-111371978 GGAAAACCAATGGCAAACACTGG + Intergenic
937573256 2:123390001-123390023 GGAAGACTCCTGGTGAACAGAGG + Intergenic
939508127 2:143074400-143074422 GGAAGGTGCATAGCAATCAGTGG - Intergenic
945935731 2:215901102-215901124 GGCAGACTCAGGGCAAACAACGG - Intergenic
946823867 2:223656749-223656771 GGAACACGCTTGGCAAAGGGAGG - Intergenic
947736178 2:232456622-232456644 GGCAGAAGAATGGCAAACTGGGG + Exonic
1171489822 20:25508935-25508957 GGAAGAGGGAAGGCAAAGAGGGG - Intronic
1173472453 20:43334349-43334371 GGAACAAGCATTTCAAACAGGGG + Intergenic
1173556585 20:43970488-43970510 GGAATATGCATGAGAAACAGAGG - Intronic
1173937637 20:46881036-46881058 GGAGGATGGATTGCAAACAGGGG + Intergenic
1174998731 20:55602299-55602321 GGAAGACACTTGGAAAACAATGG - Intergenic
1176413399 21:6461106-6461128 GGAACACGCATGGCTTACAGCGG + Intergenic
1179688896 21:43069429-43069451 GGAACACGCATGGCTTACAGCGG + Intronic
1180041340 21:45281905-45281927 GGCAGACGCATGGCCAAAGGTGG + Intronic
1180836901 22:18934451-18934473 GGAAGAGGCAGGGCATCCAGAGG - Intronic
1181547949 22:23614354-23614376 GGAAGAGGGATGGCAAAGAAGGG + Intronic
1203286994 22_KI270734v1_random:159750-159772 GGAAGAGGCAGGGCATCCAGAGG - Intergenic
955403945 3:58613608-58613630 GGAAGAAGCCAGGCAAAAAGAGG - Intronic
959381325 3:105644530-105644552 GGAAAACGCATGTCAAATAAAGG - Intergenic
962478691 3:135779979-135780001 GGAGGAGGCATGGCAGGCAGCGG - Intergenic
964580042 3:158223840-158223862 GGAGGAGGCATTCCAAACAGAGG - Intronic
965784817 3:172324467-172324489 GGATGACGCATTGCAAACGTGGG - Intronic
967825475 3:193873908-193873930 GGAAGAGGCATGGCAGTCAGAGG + Intergenic
968037898 3:195563623-195563645 GGAGGATGCATGTCAATCAGGGG + Intergenic
969314113 4:6371284-6371306 GGGAGACCCTTGGAAAACAGCGG - Intronic
977804455 4:101280294-101280316 GAGAAAAGCATGGCAAACAGAGG + Intronic
979267453 4:118719880-118719902 GCAAGACCCTTGGAAAACAGAGG - Intergenic
984820768 4:183879845-183879867 GGATGGCGCATGGCAATGAGAGG + Intronic
987883216 5:23776673-23776695 TGGAGGCCCATGGCAAACAGTGG - Intergenic
988921917 5:35950667-35950689 GGAAGAGGAATTACAAACAGTGG - Intergenic
989180755 5:38574423-38574445 GGAATACCCATGGTAAACAATGG - Intronic
996387502 5:122924990-122925012 GGAAGACGAAGGGGAAAGAGGGG - Intronic
997508424 5:134436605-134436627 GGAAGACGCACAGTAAACCGAGG + Intergenic
1000281057 5:159782439-159782461 GGAGGACGCACGGGAGACAGTGG + Intergenic
1002400612 5:178989814-178989836 GGAAGACCCAAGGCAACCACAGG + Intronic
1007823860 6:44583286-44583308 GGAAGACCCATGGGGACCAGAGG - Intergenic
1017159401 6:151350875-151350897 TGAAGACGCAGGGCCAACAGGGG + Exonic
1019109711 6:169700094-169700116 GGGAGACACATGGCAGACACTGG - Intronic
1020477609 7:8616644-8616666 GGTAGAAGCATGGCAGCCAGGGG + Intronic
1021021486 7:15603665-15603687 AGAAGAAGAATGGAAAACAGGGG + Intergenic
1023496896 7:40807569-40807591 GGAAGAAGCTGGACAAACAGAGG + Intronic
1024051444 7:45626326-45626348 GGCAGGCACATGGCAAACACAGG - Intronic
1028755603 7:94430142-94430164 GAATGACACATGCCAAACAGTGG + Intronic
1031882014 7:127208595-127208617 GGAAGAGGCATGGCAGAGACCGG - Intronic
1032559992 7:132879544-132879566 GGAAGACCCATGGGAGACTGTGG + Intronic
1033741371 7:144278135-144278157 GGAAGAAGAATGGCAAGAAGAGG - Intergenic
1033752532 7:144371479-144371501 GGAAGAAGAATGGCAAGAAGAGG + Intronic
1034955745 7:155333373-155333395 GGAAGACACTTGGCAGACAGAGG + Intergenic
1035945239 8:3954685-3954707 GGAAGAATCATGGGAAAGAGGGG - Intronic
1036183205 8:6602378-6602400 GGAAGTGGCCTGGCAACCAGAGG + Intronic
1037587619 8:20288773-20288795 GGAAGACGCAGGGGAGGCAGAGG - Intronic
1038286535 8:26210699-26210721 GGAAGATGCAGGGCAGAGAGAGG - Intergenic
1048336476 8:133506482-133506504 GGAAGAAACTTGGCAAACTGCGG + Intronic
1048874186 8:138823844-138823866 GGAAAACACATGGTACACAGTGG + Intronic
1052775276 9:32726883-32726905 GGAAGCCACATAGTAAACAGAGG + Intergenic
1061842572 9:133367930-133367952 GGATGACCCACGGCAAAGAGTGG - Intronic
1062565012 9:137160379-137160401 GGAAGATGCCTGGCATACACGGG + Intronic
1185506510 X:635326-635348 GGAAGACGGAGGGGAATCAGGGG - Intronic
1185513899 X:683970-683992 GGAACAAGCATTTCAAACAGGGG - Intergenic
1190786144 X:53651114-53651136 GGAAGACACATGACAAGCTGGGG - Intronic
1192431070 X:71111920-71111942 GGAAGAGGCATGGCATAGAACGG - Intronic
1193546825 X:82841800-82841822 AGAAGAGGCTTGGCAAGCAGCGG - Intergenic
1194966451 X:100293874-100293896 GTAAGAGGCATGGCAGCCAGTGG + Exonic
1198339225 X:135698142-135698164 GGATGGTGCATGGCAAACACCGG + Intergenic
1202330958 Y:23752397-23752419 GGAGGAGGGATGGCCAACAGTGG + Intergenic
1202539811 Y:25917664-25917686 GGAGGAGGGATGGCCAACAGTGG - Intergenic