ID: 1162306910

View in Genome Browser
Species Human (GRCh38)
Location 19:9880421-9880443
Sequence AACCTGAAAGTTGTTTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162306905_1162306910 28 Left 1162306905 19:9880370-9880392 CCAACCTCATAAAGCTTCTGCTC No data
Right 1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG 0: 1
1: 0
2: 3
3: 10
4: 181
1162306903_1162306910 30 Left 1162306903 19:9880368-9880390 CCCCAACCTCATAAAGCTTCTGC 0: 1
1: 0
2: 1
3: 13
4: 184
Right 1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG 0: 1
1: 0
2: 3
3: 10
4: 181
1162306904_1162306910 29 Left 1162306904 19:9880369-9880391 CCCAACCTCATAAAGCTTCTGCT 0: 1
1: 0
2: 1
3: 23
4: 202
Right 1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG 0: 1
1: 0
2: 3
3: 10
4: 181
1162306906_1162306910 24 Left 1162306906 19:9880374-9880396 CCTCATAAAGCTTCTGCTCTAGT 0: 1
1: 0
2: 4
3: 63
4: 299
Right 1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG 0: 1
1: 0
2: 3
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162306910 Original CRISPR AACCTGAAAGTTGTTTAATG AGG Intronic
901340163 1:8490532-8490554 AACCAGAATGTTGTTTAACAAGG + Intronic
901963814 1:12849454-12849476 AACCTGAAAGTAGTGTTGTGGGG + Intronic
901991448 1:13117549-13117571 AACCTGAAAGTAGTGTTGTGGGG + Intergenic
903317464 1:22519776-22519798 AACTTGAAAGATGTAAAATGAGG + Intronic
903523907 1:23977795-23977817 AACCTGTAACTTGATTTATGTGG - Intronic
904835590 1:33333599-33333621 AACCTGAAGCTTGTTTTCTGGGG - Intronic
906447792 1:45918429-45918451 AGCCTCAAAATTGTTTAATCTGG - Intronic
907725010 1:57011769-57011791 TACCTCAAAGATGTTTTATGAGG - Intronic
908129280 1:61058506-61058528 AACCTGAATGTTTTTTGAGGGGG + Intronic
909964895 1:81896614-81896636 AACATAAAAGTTGTTTTAAGAGG - Intronic
910046071 1:82918607-82918629 ATCCTGTATGTTATTTAATGTGG - Intergenic
910050475 1:82967989-82968011 AGCCTTTAAGTTGTTTAATGTGG + Intergenic
910328040 1:86033011-86033033 AACTTGAATGTTGTTTTAAGTGG - Intronic
910354181 1:86336085-86336107 AAGCAGAATGTTGTTTAATGAGG - Intergenic
914330737 1:146668289-146668311 AACCTGAACGTTGTATAAGAAGG + Intergenic
915708217 1:157867582-157867604 AACCAGAATCTTATTTAATGAGG + Intronic
917235963 1:172892313-172892335 AACCTGCTAGTTGTTTAATTTGG + Intergenic
917995081 1:180429221-180429243 AAATGGGAAGTTGTTTAATGGGG - Intronic
923903871 1:238361025-238361047 AACCAGAAAGTTTTTTATTTTGG + Intergenic
924542680 1:244996080-244996102 AATCTAGAAGTTGTTTAATTGGG + Intronic
1063189383 10:3679224-3679246 AAGGTGCAAGTTGTGTAATGGGG - Intergenic
1064239541 10:13613471-13613493 AACTTGATAGTTGTTTTCTGAGG + Intronic
1064597120 10:16957077-16957099 AACCAGAATATTGTTTACTGTGG + Intronic
1064916926 10:20468501-20468523 ACCCTGAAAGTTCTTAAAAGGGG + Intergenic
1064917083 10:20471115-20471137 ACCCTGAAAGTTCTTAAAAGGGG + Intergenic
1065412721 10:25447635-25447657 TAGCAGAAAGTTGTGTAATGTGG + Intronic
1067967614 10:50930361-50930383 AACCTGAAAGCTCTTTAAGAAGG - Intergenic
1081392158 11:42541892-42541914 AACCTGAATGATCTTAAATGTGG - Intergenic
1084297674 11:68223512-68223534 AAATGGAGAGTTGTTTAATGGGG + Intergenic
1088263379 11:107966445-107966467 AATCAGAATGTTTTTTAATGTGG + Intergenic
1088876028 11:113937033-113937055 CACCTGAAGGGTGTCTAATGGGG + Intronic
1090552381 11:127836799-127836821 AAGGTGAAAGCTGTTAAATGGGG - Intergenic
1093945384 12:25102205-25102227 AAGCTGAACGTTTTTTAATTTGG - Exonic
1096237762 12:49941573-49941595 TTTCTGAAAGTTGTTTAAAGTGG + Intergenic
1097481205 12:60128034-60128056 AACATTAAAATTGTATAATGTGG - Intergenic
1097907954 12:64939947-64939969 AAACTGAAAGGGATTTAATGTGG + Intergenic
1099301253 12:80897510-80897532 CACCTGAAAATTGTTTGTTGGGG + Intronic
1100694763 12:97080427-97080449 GAACTGAAAGTTGTTTAGTATGG + Intergenic
1101796461 12:107979370-107979392 AACCAGTAAGTTGTCTAATTCGG - Intergenic
1104124599 12:125834331-125834353 TAACTGAAAGTTGATTAAGGAGG - Intergenic
1104518597 12:129451885-129451907 AACCTGGAAGTTGTTTTACCTGG + Intronic
1106841441 13:33688719-33688741 GACCTGAAGGTTGTTTCCTGAGG - Intergenic
1109248873 13:59993634-59993656 AAACTTAAGGTTGTTTAAAGTGG + Intronic
1110374662 13:74778697-74778719 AAGCTGAAGGTTTTTTAATCAGG - Intergenic
1112999748 13:105620307-105620329 AACCTGAATGTTCTATAATGGGG + Intergenic
1114508774 14:23238883-23238905 AACACAAAAGTTATTTAATGTGG + Intronic
1116347882 14:43819526-43819548 AACTTGTACGTTTTTTAATGGGG + Intergenic
1121786359 14:96664037-96664059 AACCTCTAACTTGTTTAATCTGG + Intergenic
1121942246 14:98082322-98082344 AACCTGGAAGCTGTTTATTAGGG - Intergenic
1121989773 14:98544787-98544809 AACCTAAAAGCTCTTTAAAGGGG - Intergenic
1124967205 15:34443698-34443720 AACCTGAACGTTGTATTAAGTGG + Intergenic
1127566579 15:60195165-60195187 AACCTGATAGCTGCTTCATGGGG - Intergenic
1127698060 15:61471144-61471166 AACTTCAAAGTTGTTAAAAGTGG - Intergenic
1130863743 15:87914130-87914152 AATGTGAAAGTTGCTTAAAGAGG - Intronic
1134401947 16:13918403-13918425 AGCCTGTAGGTTGTTTTATGTGG - Intergenic
1139089436 16:63627157-63627179 TGGCTGAAACTTGTTTAATGTGG - Intergenic
1139128585 16:64112842-64112864 TACCTGAGCTTTGTTTAATGTGG - Intergenic
1140002815 16:71042616-71042638 AACCTGAACGTTGTATAAGAAGG - Intronic
1143781857 17:9233287-9233309 AGCCTGCAAGTTGTTTATTCGGG + Intronic
1145199185 17:20925708-20925730 AAATTGGGAGTTGTTTAATGGGG - Intergenic
1146328571 17:31908302-31908324 AACCTAAAAGTTATTTAAGCTGG - Intergenic
1148917927 17:50999325-50999347 AATCAGAAACTTATTTAATGGGG + Intronic
1151428409 17:74046362-74046384 TACCTGAGAGTTGGCTAATGAGG - Intergenic
1158254995 18:55536370-55536392 AAGCTGAAAGAGGTTTAAAGAGG - Intronic
1159377841 18:67616657-67616679 AACTTGAAAGGTGATTAATCTGG + Intergenic
1159814212 18:73053159-73053181 AGACTGAAGGTTGTTTACTGAGG - Intergenic
1161625787 19:5325750-5325772 TCCCTGACAGTTGTTTACTGAGG - Intronic
1161908073 19:7172378-7172400 ACCCTGAAATTTCTTCAATGAGG + Exonic
1162287924 19:9753962-9753984 AAATTGAAAGTGGTATAATGAGG + Intronic
1162306910 19:9880421-9880443 AACCTGAAAGTTGTTTAATGAGG + Intronic
1164339197 19:24370453-24370475 AACCAGAAAGATGTTTTCTGAGG + Intergenic
925662041 2:6213054-6213076 ATCCTGAAAGATGTTTGACGAGG + Intergenic
925761678 2:7190953-7190975 AACATGATTTTTGTTTAATGTGG - Intergenic
926804201 2:16689484-16689506 AACCTGAAAGTCGTTGGAAGTGG - Intergenic
930225310 2:48786224-48786246 AAACTGAAAAGTGTTTATTGAGG - Intergenic
930320094 2:49843669-49843691 AATTTGAAAGGTGATTAATGTGG + Intergenic
931441250 2:62292405-62292427 AAACTGAAAGTTGCCTAATCTGG + Intergenic
932469229 2:71943113-71943135 AACATGAAAGTAATTTCATGGGG + Intergenic
934862444 2:97775501-97775523 AATCTGAAAGAAGTTTCATGAGG + Intronic
935682639 2:105651376-105651398 TTCCTGAAAGGTGTTTTATGTGG + Intergenic
936100078 2:109569610-109569632 AACAGGAAAGTTGTTTACTTAGG - Intronic
937483500 2:122289306-122289328 GACATGAAACTTGTTTCATGGGG - Intergenic
937987930 2:127646954-127646976 AACCAGAAAGCTGTTTAAAATGG + Intronic
938507462 2:131901414-131901436 AACCAGAAAGTTTTTTATTAAGG + Intergenic
939118286 2:138086894-138086916 AACCTTATAATTCTTTAATGAGG - Intergenic
940703353 2:157074095-157074117 AACCTAAATGTTGTTGAAAGGGG + Intergenic
942016564 2:171823112-171823134 AACCTGAAATATGTTAACTGAGG + Intronic
942495571 2:176536423-176536445 ATCCTGAAAGTGGTTTTAAGTGG - Intergenic
942605752 2:177688829-177688851 AACCAGAAAGTTTTTCAATGTGG - Intronic
943889128 2:193263650-193263672 AACTTGAGAGTAGTTAAATGCGG + Intergenic
943958403 2:194224412-194224434 CACCTGAACATTTTTTAATGAGG + Intergenic
945395477 2:209310326-209310348 GACCTGAAAGTTGTTGAGTTTGG + Intergenic
1170509932 20:17066105-17066127 AATCTGAAGTTTGTTTCATGTGG + Intergenic
1172613304 20:36267236-36267258 AACCTCACAGTCATTTAATGAGG - Intronic
1176888259 21:14282583-14282605 AACCTGAATTTTGTTTATGGGGG + Intergenic
1177498705 21:21921998-21922020 AGCTTTAAAGTTGTTTATTGTGG - Intergenic
1177984777 21:27960940-27960962 AACCAGAAAGTTTTTTATTAAGG - Intergenic
1178813981 21:35910486-35910508 AATCTGATAGTTTTTTAAAGGGG + Intronic
1179532295 21:42028141-42028163 ATGGTGAAAGATGTTTAATGGGG - Intergenic
1180166064 21:46030071-46030093 AACCTGAAATTTTGTTAATTTGG + Intergenic
1183550739 22:38482636-38482658 AACCAGAAAAGTGTTTAGTGTGG + Intronic
1184354328 22:43968931-43968953 AACCTGAAAGTTGATCAAACAGG + Intronic
950494051 3:13323296-13323318 AACCTGAGAGGTACTTAATGAGG - Exonic
950979482 3:17287418-17287440 AACCTGAAAATTGTTTCATGGGG + Intronic
951059837 3:18192508-18192530 AAAGTTAAAGTTGTTAAATGAGG + Intronic
951755819 3:26089855-26089877 AATCTGAAAGCTATTAAATGGGG + Intergenic
952661268 3:35850964-35850986 AAACCTAAAGTTGTTTAAAGAGG - Intergenic
953035950 3:39211121-39211143 AATCTGAAAATAGTTTTATGGGG - Intergenic
957239889 3:77644969-77644991 AATCTGAAATTTGTTTAATGTGG - Intronic
958777153 3:98499539-98499561 AAACTTAAAGTCGTTTAATATGG + Intronic
959151993 3:102618810-102618832 AGCCTGCAGGATGTTTAATGAGG - Intergenic
962206786 3:133441404-133441426 AACCTGATAGTTGTTACCTGGGG - Intronic
963198322 3:142559015-142559037 AACTTCAAAGTTTTTTAATTTGG - Intronic
963429247 3:145176283-145176305 AAAATGAAAGTTATTTAATGTGG - Intergenic
963847714 3:150176735-150176757 AAACTGAAAGTTGATAAATATGG - Intergenic
963981947 3:151547880-151547902 AAACTGGAAGTTGTATAGTGAGG - Intergenic
967030967 3:185606392-185606414 ATCCAGAGAGTTCTTTAATGTGG + Exonic
968709872 4:2106234-2106256 AATCTGAAAAGTGTTAAATGGGG + Intronic
968796472 4:2709038-2709060 AACATTAAATTTTTTTAATGTGG - Intronic
969386560 4:6853658-6853680 AACCTGTAAGATGATTAATATGG + Intronic
970050081 4:11904580-11904602 AACCAGACAGTGGTTTACTGAGG - Intergenic
970617719 4:17782901-17782923 AAGCAGAGAGCTGTTTAATGTGG - Intergenic
974044104 4:56882961-56882983 AACCTGAAAGTTGTTTATTTTGG + Intergenic
974246592 4:59328099-59328121 AACCTGACATTTTTATAATGGGG + Intergenic
974769220 4:66388923-66388945 AGCTTGAAAGTTTTTTAAAGAGG - Intergenic
975777250 4:77800641-77800663 AACATAAAAGTTGTGTAAAGAGG + Intronic
976633386 4:87262874-87262896 AACCTGAAGGTTGTTTCCTGAGG - Intergenic
978934400 4:114357907-114357929 AACCTGAAAGTTATTGAAGGAGG - Intergenic
979352780 4:119664838-119664860 AACCTCTAAGTTATTTATTGCGG - Intergenic
981515898 4:145609297-145609319 AACCTGAAACTTGGGGAATGAGG - Intergenic
981793486 4:148567803-148567825 AACCTGATTGTTGGTTAATGTGG + Intergenic
981907735 4:149942079-149942101 AACCTAAAAGTTCTTTAGTCTGG + Intergenic
982971133 4:161988510-161988532 CAATTGAAAATTGTTTAATGTGG - Intronic
982982517 4:162157752-162157774 AACCAAAAACTTGTATAATGGGG + Intronic
985011446 4:185587208-185587230 GACCAGAAAATTGTTTATTGGGG - Intronic
986501723 5:8408006-8408028 AACATGAAACTTGTTTATAGAGG + Intergenic
988536918 5:32077417-32077439 AGCCTGAAAGTTATTTCAAGTGG + Intronic
990535502 5:56717577-56717599 AACCTGACAACTGGTTAATGTGG + Intergenic
990573786 5:57105413-57105435 CACCTGAAAGGTGTTCCATGAGG + Intergenic
991128866 5:63098199-63098221 CACCTGAAATTTCTTTAATTGGG - Intergenic
992363376 5:76065995-76066017 ACCCTGAAAGTGGTTTAAACTGG - Intergenic
993157815 5:84249109-84249131 AAACTGAAAGAAGTTAAATGTGG - Intronic
993435395 5:87886789-87886811 AAACTGAAAATTTTTTAGTGAGG - Intergenic
994670847 5:102759693-102759715 AAACTGAGAGGAGTTTAATGTGG + Intronic
1002654842 5:180737716-180737738 ACCGTGAAAGTTGATTAATAAGG + Intergenic
1003966970 6:11261972-11261994 AATTTGAAAGGTGTTTAAGGTGG - Intronic
1005772611 6:29090688-29090710 AAATTTAAAGTTGTTTAATTAGG + Intergenic
1009974144 6:70655185-70655207 GACCTGAAAGATGTTTATTAGGG + Intergenic
1010298621 6:74231648-74231670 ACCCTGAAACTTGTGTAATTGGG - Intergenic
1011535067 6:88367937-88367959 AAACTGAAAAGGGTTTAATGTGG + Intergenic
1011722527 6:90172945-90172967 AACCTTAGAGTTCTTTAATTTGG - Intronic
1011788428 6:90871420-90871442 AACCTGAGAGATGAATAATGTGG + Intergenic
1012113468 6:95263441-95263463 GACTTGAAAGATGTTGAATGGGG + Intergenic
1013258163 6:108410596-108410618 AATCTTAAAGTTGTTTATTCAGG - Intronic
1015128297 6:129779839-129779861 AACCTGAAACCTGTGTAATTGGG + Intergenic
1015427248 6:133085667-133085689 AACCTGAAAGTTTTATAAATTGG + Intergenic
1016209981 6:141520245-141520267 AATCTGACAGTTGTTTACTTGGG - Intergenic
1017291350 6:152742388-152742410 AACCTGAAAGTTGTTCCACGTGG + Intergenic
1017421167 6:154274669-154274691 AACCTGAAACTTCTAAAATGTGG + Intronic
1018855694 6:167673277-167673299 TACCTGCAAGCTGTTTCATGGGG - Intergenic
1019950511 7:4368447-4368469 AACCTGAAAAATGATTAAAGAGG + Intergenic
1020727699 7:11836461-11836483 ATGTTGAAAATTGTTTAATGTGG - Intergenic
1020775131 7:12443452-12443474 TAACTGAAAGTTGTTGAGTGTGG - Intergenic
1023278381 7:38544788-38544810 GATCTGAAAAGTGTTTAATGAGG + Intronic
1024111837 7:46155046-46155068 ATCTTGCAAGTTGTTTAATTGGG - Intergenic
1026374412 7:69736102-69736124 AAAGTGAAAATTGTTTAAAGTGG + Intronic
1026857903 7:73767085-73767107 AACCTGAAAGTCGTTGCATAGGG - Intergenic
1035843034 8:2833090-2833112 GAACTGAAAGTTGTTTCATTTGG - Intergenic
1037477777 8:19274295-19274317 ACCCTGGAAGTAGATTAATGGGG - Intergenic
1039779398 8:40769535-40769557 AACCTGCAAGATGCTGAATGTGG + Intronic
1042397256 8:68306819-68306841 GGCCTGAAAGTTGTTTCCTGAGG - Intronic
1043825982 8:84929142-84929164 TACCATAAATTTGTTTAATGTGG + Intergenic
1043888004 8:85624536-85624558 TAACTGAAAGTTTTTAAATGGGG + Intergenic
1043939659 8:86182561-86182583 AAACTTAAAGTTGGTCAATGTGG - Intergenic
1043998671 8:86850723-86850745 AGCAGGAAAGTTGTTAAATGAGG - Intergenic
1044346990 8:91116746-91116768 AAGCTGAATTTTGTCTAATGTGG - Intronic
1044416717 8:91948012-91948034 AACCTGAATGATGTAGAATGGGG - Intergenic
1045549061 8:103153984-103154006 AACATGCCAGTTGTTTATTGAGG - Intronic
1045805171 8:106150760-106150782 AAACAGAAAGTTGTCCAATGGGG + Intergenic
1048290654 8:133178922-133178944 AGCTTGAAATTTGATTAATGAGG - Intergenic
1048357469 8:133665230-133665252 TACCTGAGAGGTATTTAATGGGG + Intergenic
1048760376 8:137788031-137788053 AACCTGAAAGTTGAGAAAGGAGG - Intergenic
1050817194 9:9830383-9830405 TACCTGATATTTGTTAAATGGGG + Intronic
1051787692 9:20763691-20763713 GACCTGAAAGGAGTTTAGTGTGG + Intronic
1052455212 9:28688205-28688227 ATCCTTAAAGGAGTTTAATGGGG - Intergenic
1055141672 9:72883430-72883452 AACCTGAATGTTTTGTAGTGAGG - Intergenic
1058815677 9:108680756-108680778 AACCTGATGGTTGGTTCATGGGG + Intergenic
1059054353 9:110963163-110963185 AACATGAAAGGTGTCTTATGTGG + Intronic
1185804434 X:3044500-3044522 AAACTGAAAGATGATGAATGTGG + Intronic
1187097077 X:16160376-16160398 AATCTGAAAGTTCATCAATGGGG - Intergenic
1187738590 X:22329911-22329933 AACCTGGATGTTCTTCAATGGGG - Intergenic
1187824928 X:23325252-23325274 AACAAGAAAGTTGTGTAGTGTGG - Intergenic
1195437478 X:104862081-104862103 AATTTGAAAGTAGTTTGATGAGG + Intronic
1199268867 X:145859248-145859270 AACATGAAAGTGTTTTAATTTGG - Intergenic
1201747053 Y:17388173-17388195 AACCTGAGTTTTTTTTAATGGGG + Intergenic