ID: 1162307358

View in Genome Browser
Species Human (GRCh38)
Location 19:9883311-9883333
Sequence CTGACTCAGCCCATCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162307351_1162307358 30 Left 1162307351 19:9883258-9883280 CCAGGGCAAAACACAGGCAAAAA 0: 1
1: 0
2: 4
3: 58
4: 427
Right 1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 224
1162307355_1162307358 -4 Left 1162307355 19:9883292-9883314 CCAGGTAAGCATATCCAGGCTGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 224
1162307353_1162307358 6 Left 1162307353 19:9883282-9883304 CCAACAAATTCCAGGTAAGCATA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162307358 Original CRISPR CTGACTCAGCCCATCCCTCT GGG Intronic
901059816 1:6466848-6466870 CACACTCAGGCCAGCCCTCTTGG - Exonic
901921403 1:12540231-12540253 CTGAGTGAGCTCAGCCCTCTCGG - Intergenic
902199400 1:14822540-14822562 CTCTCTCAGCCCCTCCCTCCTGG + Intronic
904309072 1:29613875-29613897 CAGCCTCTGCCCATCTCTCTGGG - Intergenic
906519077 1:46456716-46456738 CTGTCTCAGCCCAGGCTTCTAGG - Intergenic
906805405 1:48775794-48775816 CTGCCTTAGCCCATCTCTCAGGG + Intronic
907282709 1:53361610-53361632 CAGACTCAGCACTTCCTTCTGGG - Intergenic
911816940 1:102365239-102365261 CTGACTCCTCTCATCTCTCTAGG + Intergenic
915023236 1:152801832-152801854 ATGACTCAGGCCATCCTTATAGG - Intronic
915323463 1:155068856-155068878 CTGAGTCAGCCCATCCTGTTGGG + Intronic
915727851 1:158031473-158031495 CTGACTCCTTCCATCCCACTTGG - Intronic
916936554 1:169633708-169633730 ATGACTGAGGACATCCCTCTTGG - Intergenic
917682750 1:177384610-177384632 CTGACTCATCCCTTCTCACTGGG - Intergenic
918825328 1:189316575-189316597 CTGACTCTGCCCAGGTCTCTTGG - Intergenic
920075247 1:203331421-203331443 ATGACTCAGCAGTTCCCTCTTGG + Intergenic
920869010 1:209777716-209777738 CTTTTTTAGCCCATCCCTCTGGG + Intronic
921366955 1:214383427-214383449 CTCTCTCGGCCCATCCATCTCGG - Exonic
922054968 1:222033071-222033093 CAGATACGGCCCATCCCTCTAGG + Intergenic
922786310 1:228284040-228284062 CTGAGTCAGGCTGTCCCTCTGGG - Intronic
1063835280 10:10005191-10005213 CTGACCCTGCCCTTCCCTGTTGG + Intergenic
1064972373 10:21079122-21079144 CTGTCTCAGCCTCTCTCTCTCGG + Intronic
1066199307 10:33129871-33129893 CTGACTCAGCCCAGCCTTAGAGG + Intergenic
1070458462 10:76641690-76641712 CTAACTAAGCCAAACCCTCTTGG + Intergenic
1071524502 10:86350360-86350382 CTGCCTCTGCCCTTCCCTCCAGG - Intronic
1075263874 10:120984510-120984532 CTGACACAGCCCCTGCCTCATGG + Intergenic
1075763997 10:124878556-124878578 CCCACTCAGCCCTTCCCACTTGG + Intergenic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1076337823 10:129720390-129720412 CTGGCTCAGCACAGCCCTCGCGG + Intronic
1077172646 11:1174798-1174820 GTGAGTGAGCCCAGCCCTCTCGG - Intronic
1077347562 11:2070933-2070955 CTGCCTCAGCCTCTCCTTCTAGG + Intergenic
1077852076 11:6082921-6082943 CTGAATCAGGCCATCCATTTAGG + Intergenic
1078222394 11:9362725-9362747 CTGCCCCAGCTCAACCCTCTGGG - Intergenic
1079385870 11:19979141-19979163 CTGAGTCATCCCAGACCTCTGGG - Intronic
1081742296 11:45449113-45449135 AGGACTCAGCCCATCCCCCAGGG - Intergenic
1082027586 11:47584205-47584227 CTTCCCCAGCCCATTCCTCTCGG - Intronic
1082814406 11:57498831-57498853 CTGCCTCAGCCAAGCCCTCAGGG + Intronic
1083226543 11:61288530-61288552 CTGACTAACCCCATTCCACTGGG + Intronic
1083991752 11:66250428-66250450 CTGACTCAGGCCATATCTCAGGG + Intergenic
1084311161 11:68317102-68317124 CTGCCTCCGCCCATCACACTTGG - Intronic
1084813104 11:71627642-71627664 CTCACTCTGCCCTTCCCTTTGGG + Intergenic
1084823001 11:71706818-71706840 TTGACTCTGCCCATTTCTCTAGG + Intergenic
1084965724 11:72743555-72743577 CTCACTCTGCCCATCTCTCCAGG - Intronic
1085018710 11:73191792-73191814 CTGAAGGTGCCCATCCCTCTGGG - Intergenic
1088537253 11:110874815-110874837 CTGGCCCTGCCCTTCCCTCTAGG - Intergenic
1089533645 11:119148278-119148300 CTTTCTCAGCCAATTCCTCTTGG - Intergenic
1089659995 11:119979486-119979508 CTGAGTGAGCCCCTCCCTTTCGG - Intergenic
1089715437 11:120354267-120354289 CTGACTCACCCAACCACTCTGGG - Intronic
1090064690 11:123492525-123492547 CTGAATCTGCCCTGCCCTCTTGG + Intergenic
1091279430 11:134373668-134373690 CTGACTCGGCCCCTGCCTTTGGG + Intronic
1091767428 12:3130688-3130710 CTGACTCTGCACATCTCTGTGGG - Intronic
1092708654 12:11310582-11310604 CCAACCCACCCCATCCCTCTGGG - Intergenic
1093045763 12:14442416-14442438 CTGATTCTGCCCTTCACTCTGGG + Intronic
1094417918 12:30236728-30236750 CTGACTCTGCCCCTCCTTCCTGG - Intergenic
1096203801 12:49705676-49705698 CTGACTCACCCGATCCCCCGAGG + Intronic
1096808453 12:54154961-54154983 GTGACTCAGCCCCAGCCTCTAGG + Intergenic
1097234846 12:57532335-57532357 CTGCCTCAGCCATCCCCTCTGGG - Intronic
1102584131 12:113911274-113911296 CTGGCTCAGCCTGTCCCTCAAGG + Intronic
1103704296 12:122862969-122862991 CAGGCACAGCCCCTCCCTCTGGG - Intergenic
1104604518 12:130178179-130178201 CTCTCTCAGCCCATCCTTCCCGG + Intergenic
1104676373 12:130714769-130714791 CAGACCCTGCCCATCCCACTGGG + Intronic
1106235121 13:27854774-27854796 ATGACTCAGCACTTCACTCTTGG - Intergenic
1108993911 13:56700178-56700200 CTGAGACAACCTATCCCTCTGGG + Intergenic
1110070716 13:71173964-71173986 CTGACTCTGCCCACTCCACTGGG + Intergenic
1112110331 13:96290259-96290281 ATGAGTCAGGCCATCCCCCTTGG - Intronic
1112174246 13:97006132-97006154 TAGACTCAGCCCTTCCCACTGGG - Intergenic
1112326412 13:98445160-98445182 CTGCCTCATTCCATCTCTCTGGG - Intronic
1112439988 13:99418210-99418232 CTGCCTCAGCTCTTCCTTCTGGG - Intergenic
1112440658 13:99422397-99422419 GTGACTCAGCCCACCTCTCTGGG - Intergenic
1114258594 14:21022302-21022324 CTGACCCCTCCCCTCCCTCTGGG + Intronic
1115468116 14:33738412-33738434 CTGATTGAGACCTTCCCTCTGGG + Intronic
1117055197 14:51905143-51905165 CTGAATCACCCCATCACTCAGGG + Intronic
1117218938 14:53581848-53581870 CTGACTGAGTCCATGCCCCTGGG + Intergenic
1118009169 14:61592064-61592086 CTGCCCCAGCCCCTCCCTCCAGG + Intronic
1118315170 14:64721707-64721729 CTGACCCCTCCCATCCCTCCTGG - Intronic
1119216904 14:72876249-72876271 CTCCCTCACCCCACCCCTCTGGG + Intronic
1121435345 14:93915487-93915509 CTGGCTCAGCCCACGCCTCTTGG - Intergenic
1121706798 14:96002374-96002396 CTGACTCATCCCACCTCACTGGG + Intergenic
1121794061 14:96721215-96721237 CAGAATAATCCCATCCCTCTAGG + Intergenic
1122642011 14:103165466-103165488 CTGGCTCAGCCCATGCTTCATGG + Intergenic
1122725714 14:103750323-103750345 GTGACTCAGGCCATCCTTTTTGG - Intronic
1122839841 14:104451797-104451819 CTGCCTGGGCCCAGCCCTCTTGG + Intergenic
1123153837 14:106206260-106206282 TTGACTCAGCCCATTACTCTAGG - Intergenic
1124232274 15:27955872-27955894 CTGACTCAGCCCACCCCTCCTGG + Intronic
1126227564 15:46289415-46289437 CAGGCTCAGCTCAGCCCTCTTGG + Intergenic
1128114269 15:65095434-65095456 CTGACACAGCCCCTCCCTCATGG - Intronic
1128220043 15:65962656-65962678 CTTAAACAGCCCATCCCTCTAGG - Intronic
1128358176 15:66943036-66943058 CCAACACAGCCCATCCCACTTGG + Intergenic
1129194358 15:73955335-73955357 CTGACCCAGCACCTCCTTCTGGG + Intergenic
1130220831 15:82018186-82018208 CTGCCACAGGCCACCCCTCTGGG + Intergenic
1130944233 15:88538928-88538950 TTGACTCAGCCCGTTACTCTAGG + Intronic
1133750115 16:8718636-8718658 CTGAGCCAGCCCCTGCCTCTGGG + Intronic
1134135155 16:11672718-11672740 CTGGCTCTGCCCATGCCTCCTGG + Intronic
1135422890 16:22316683-22316705 CTGGCCCAGCCCATCCCACCTGG - Exonic
1136536623 16:30903352-30903374 CTGCCACACCCCATCCCTTTGGG + Exonic
1137727755 16:50668613-50668635 CTCACACAGCCCTTCCCTCTGGG - Intronic
1138274113 16:55718869-55718891 ATGTCACAGCCCATCCCTCTGGG - Intergenic
1139493389 16:67299302-67299324 TTGGCTCTGCCCTTCCCTCTAGG - Intronic
1142122573 16:88394152-88394174 CTGTCAAACCCCATCCCTCTCGG - Intergenic
1142168370 16:88605944-88605966 CTGACGCTGCCCAGACCTCTGGG + Intronic
1142264046 16:89055446-89055468 CTGACTCAGCCCATCTGTCGGGG - Intergenic
1143213004 17:5203392-5203414 GTGACTCAGGCCATCCCTCTGGG + Intergenic
1144409625 17:14988047-14988069 CTGTCTCAGCCCCTGCCCCTTGG - Intergenic
1146274583 17:31508616-31508638 CGGCCTCAGACCCTCCCTCTTGG + Intronic
1147652205 17:42069109-42069131 CAGCCTCAGCCCATCTCTCAGGG - Intergenic
1147687561 17:42295855-42295877 CTGACCCAGCTCTACCCTCTAGG - Intronic
1151821570 17:76499833-76499855 CTGCCTCAGCCCAGCCTTCCTGG + Intronic
1151975164 17:77480385-77480407 CCGATTCAAGCCATCCCTCTCGG - Intronic
1152279877 17:79379011-79379033 CTGACTCTGGCCATGCCTCCTGG + Intronic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1153982452 18:10321835-10321857 CTGGGTCAGCCTGTCCCTCTGGG - Intergenic
1158406078 18:57160828-57160850 TTAGCTCAGCCCATCCCTCGAGG - Intergenic
1158437003 18:57440835-57440857 CCGACTCAGCCCACCTCTCCTGG + Intronic
1160551364 18:79695594-79695616 CTGGAGCAGCCCCTCCCTCTGGG + Intronic
1161420321 19:4173097-4173119 CTGGCCCAGCCCCTCCTTCTGGG - Intergenic
1162145682 19:8611143-8611165 CTCACTCAGCCCCTTCCTCCAGG - Intergenic
1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG + Intronic
1162307605 19:9884796-9884818 CAGACTCAGCCCTGCCCTTTTGG - Intronic
1163576054 19:18111272-18111294 CTGATTCAGTCCATCCCCCGGGG + Intronic
1165299618 19:34960584-34960606 CTGACTCGGCCATTCCCTCCTGG - Intronic
1165523138 19:36330168-36330190 TTGACTCTGCCCATTTCTCTAGG - Intergenic
1166230912 19:41425507-41425529 CTGGCTCAGCCCCTCCTTCCAGG - Exonic
1166713086 19:44949439-44949461 CTGAGTCAGCCCCTCCATCTTGG - Exonic
1167095698 19:47373894-47373916 CTGACTCGGTCCACCCCTCCAGG - Intronic
925173580 2:1767310-1767332 GAGACTCAACCCATCCCCCTGGG - Intergenic
926327999 2:11801987-11802009 CTGGCTCAGCACCTTCCTCTAGG - Intronic
929449743 2:42028761-42028783 CTGGCCCAGCCCCTGCCTCTGGG + Intergenic
932479818 2:72032510-72032532 CTGATTCATCCCAGCTCTCTTGG - Intergenic
934129284 2:88931904-88931926 CTCTCCCTGCCCATCCCTCTGGG - Intergenic
934552520 2:95271044-95271066 CTGTCTCAGACCCTCTCTCTGGG - Intergenic
937087535 2:119181367-119181389 CTGACCCAGCCCAGCCTCCTGGG + Intergenic
937226805 2:120374980-120375002 TTGAGACAGCCCATCTCTCTTGG - Intergenic
938065247 2:128278477-128278499 ATGTCTCAGCCCTTCCCTCCAGG - Intronic
940331801 2:152483294-152483316 CTGTTTCAGCACATTCCTCTAGG - Intronic
942249792 2:174037876-174037898 CTGGGACAGCCAATCCCTCTTGG - Intergenic
944234889 2:197433194-197433216 CTGTCTGTGCCCATCCCTATGGG - Intronic
945778379 2:214135619-214135641 CTCACTCATCCCCTCCCTCAGGG - Intronic
1169301342 20:4444241-4444263 CTGTTTCAGCCCATCTCTCTGGG - Intergenic
1170571913 20:17637373-17637395 CTGGTTGAGGCCATCCCTCTGGG - Intronic
1171993776 20:31716902-31716924 CTGAGTCAGGCAATCCCACTGGG - Intronic
1172884718 20:38223329-38223351 CTGACTTATCCCTGCCCTCTTGG - Intronic
1173889437 20:46494250-46494272 CTAACTATGCCCATCCCACTTGG - Intergenic
1173940148 20:46904098-46904120 CTGAGTCAGTCCATCACTCACGG + Intronic
1174084259 20:47994234-47994256 CTGAATCACCCCTTCCCTGTGGG + Intergenic
1179933955 21:44590938-44590960 CTGCCTCATCCCATGCCCCTCGG + Intronic
1179940938 21:44638601-44638623 CTGCCTCATCCCATGCCCCTCGG - Intronic
1180016433 21:45088332-45088354 CTGACACACCCCATCCATTTTGG - Intronic
1180063855 21:45403267-45403289 CTGCCCCAGCCCCTCCCTCCTGG + Intergenic
1181433115 22:22894835-22894857 CTGCCCCAGCCCAGCCCACTTGG - Intronic
1182115287 22:27753003-27753025 CTGCCTGGGCCCATCCCTCTGGG - Intronic
1182679640 22:32068614-32068636 CTGAGACAGCCCAGCCCTCTGGG - Intronic
1183098329 22:35567972-35567994 CAGGCTCAGCCCATCCATTTCGG - Intergenic
1183376285 22:37467397-37467419 CACACTCAGCCCCTGCCTCTGGG + Intergenic
949706197 3:6820202-6820224 CTGACTAGACTCATCCCTCTGGG + Intronic
950006870 3:9697072-9697094 CTGATTCATCCCTTCCCTCTGGG + Intronic
950013815 3:9742384-9742406 CAGACTCAGTCCCTGCCTCTGGG - Intronic
950707742 3:14793449-14793471 CTGACCCAGCCCAGGCCTTTGGG + Intergenic
950906071 3:16539504-16539526 TTGACACATCCCTTCCCTCTAGG + Intergenic
952207581 3:31195652-31195674 CTGACTCAGCCCCTTCCAATGGG - Intergenic
952400554 3:32959516-32959538 CTGACTCAGTCCATAACTCAAGG - Intergenic
953563977 3:44015343-44015365 CTGCCTCAGCCCAGGCTTCTGGG + Intergenic
954677114 3:52322151-52322173 CTCACTCAGCCCTTAACTCTGGG + Intronic
954757319 3:52848295-52848317 CTGCCTCAGCCCCTGCCCCTGGG - Intronic
955096288 3:55801392-55801414 CTGACTTTTCACATCCCTCTTGG - Intronic
959649703 3:108739743-108739765 CTCCCTCAGCCCTTCACTCTTGG + Intergenic
961289306 3:125832768-125832790 TTGACTCTGCCCATTTCTCTAGG + Intergenic
963319994 3:143801161-143801183 CTGACTCATCCCAACCCTTTTGG + Intronic
963525671 3:146411307-146411329 TTGACTCAGCCCCTTACTCTAGG - Intronic
965104626 3:164341077-164341099 TTGACTCAGCCCGTTACTCTAGG - Intergenic
965205224 3:165713334-165713356 CTGACTCAGCACAGGCCTGTAGG - Intergenic
967133691 3:186495560-186495582 CTGACCCAGCCAATCCTTTTGGG - Intergenic
968922094 4:3527581-3527603 CTGGCTCAGACCATCACTGTGGG - Intronic
976531317 4:86155989-86156011 CTATCTCATCCCATCCTTCTGGG - Intronic
980721647 4:136705153-136705175 CTGAATCAGCCTGTCCTTCTTGG - Intergenic
989600485 5:43196085-43196107 CTGCCTCAGCCCACACCACTTGG - Intronic
991352338 5:65732269-65732291 CTGGCCCGGGCCATCCCTCTGGG - Intronic
995681795 5:114728636-114728658 CTGACTCTCCCCAAACCTCTTGG - Intergenic
996393177 5:122985895-122985917 CGGACTCAGCCCTGCCCTCTTGG + Intronic
997240382 5:132302235-132302257 CAGACTTTGTCCATCCCTCTTGG + Intronic
997692527 5:135836160-135836182 CTGACTCAGCCCTACCTTCCAGG - Intronic
1001317344 5:170653184-170653206 CTGACAGATGCCATCCCTCTTGG - Intronic
1004419648 6:15457438-15457460 CTCAGTCAGCCCATCACCCTTGG + Intronic
1006407806 6:33855404-33855426 CTGACACAGCCCACCAGTCTAGG + Intergenic
1007841108 6:44716447-44716469 TTGCCTCTGCCCTTCCCTCTAGG - Intergenic
1008626799 6:53325077-53325099 CTGACTCTGCCCAACACCCTAGG + Intronic
1009601129 6:65801310-65801332 CTAACTCTGCCTATCCCTTTTGG - Intergenic
1011355989 6:86473833-86473855 TTGACTCAGCCCGTTACTCTGGG + Intergenic
1013528464 6:110997380-110997402 CTTACTCTGCCTATGCCTCTTGG - Intronic
1013630366 6:111980444-111980466 CTGACTCAGCCTGTGCCTTTGGG + Intergenic
1013713359 6:112927841-112927863 CTGACTCAGACAATCCCTACAGG + Intergenic
1014221815 6:118805637-118805659 CTGCCTCCACACATCCCTCTGGG + Intergenic
1015932378 6:138374744-138374766 TTTACTCAGCCCATCCCATTTGG + Intergenic
1019209707 6:170395139-170395161 ATGACCAAGCCCATCCCTCTAGG - Intronic
1019511848 7:1421671-1421693 CTGACACAGCCCTGGCCTCTGGG + Intergenic
1022500348 7:30878636-30878658 CTGTCCCACCCCATCCCTCCTGG - Intronic
1023822102 7:43986155-43986177 CTGAGACCGCCCATGCCTCTTGG - Intergenic
1024355058 7:48405987-48406009 CTGAAGCAGCCCAAACCTCTAGG + Intronic
1026111682 7:67463469-67463491 CTGACTGAGCCCTTCCCTTGGGG + Intergenic
1027230299 7:76268245-76268267 CAGGCCCAGCCCATCCATCTGGG - Intronic
1028125741 7:87110896-87110918 CTGATACAGAGCATCCCTCTTGG - Intergenic
1029466500 7:100728615-100728637 CTGACTCAAATCCTCCCTCTGGG + Intergenic
1029673365 7:102049223-102049245 CAGACTCAGCGCAGCCCTTTGGG + Intronic
1029750366 7:102539569-102539591 CTGAGACCGCCCATGCCTCTTGG - Intronic
1029768318 7:102638677-102638699 CTGAGACCGCCCATGCCTCTTGG - Intronic
1031011277 7:116526704-116526726 CTGTCCCAGCCCTTCCCTGTTGG - Intronic
1031964140 7:128015203-128015225 CTGACCCAGCCCCTTCATCTTGG - Intronic
1033290732 7:140080591-140080613 CTGACCCACCCCATCCCACTGGG + Intergenic
1033714723 7:143988282-143988304 CTGATTAAGCACTTCCCTCTAGG + Intergenic
1034443761 7:151101377-151101399 CTGACTCATGCCCTCCCTGTTGG + Intronic
1035442113 7:158910472-158910494 CTGACACAGCCAATCGCACTCGG - Intronic
1035442188 7:158910824-158910846 CTGACACAGCCAATCACCCTTGG - Intronic
1035442228 7:158911015-158911037 CTGACACAGCCAATCGCCCTCGG - Intronic
1035627783 8:1085835-1085857 CTGAATCTGCACATCCCTTTGGG + Intergenic
1037967525 8:23145895-23145917 CTGACCTTGACCATCCCTCTGGG + Exonic
1038983340 8:32782897-32782919 TTGTCTCAGCCCCTACCTCTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040744307 8:50621233-50621255 GTGACTCAGACCATGCCTCCAGG + Intronic
1040959207 8:53013206-53013228 CAGCCTCAGCCCTTCCCTCAGGG + Intergenic
1041481057 8:58320193-58320215 GTGACACAGCCTCTCCCTCTGGG + Intergenic
1042799415 8:72702596-72702618 CTGTCTCAGACCACCACTCTTGG + Intronic
1046214246 8:111121584-111121606 ATGATTCAGATCATCCCTCTAGG - Intergenic
1047757324 8:127928628-127928650 CTTACTCACCGCACCCCTCTGGG - Intergenic
1049447842 8:142639629-142639651 CTGGCTCAGCCCAGCGCTCATGG + Intergenic
1049814466 8:144591683-144591705 CTGACACAGCCCCGCCCTCCAGG - Intronic
1049905299 9:211175-211197 CAGTCTCTGCCCATCCCTCAGGG - Intergenic
1053240775 9:36493043-36493065 CTGCCTCAGCCCCTTCCACTTGG - Intergenic
1056534281 9:87514359-87514381 CTGTCTCAGCCCAGACCTCTGGG - Intronic
1057116175 9:92524476-92524498 TTCACTCAGCCAATCTCTCTTGG + Intronic
1057322454 9:94027007-94027029 CTGACTCAGCAATTCACTCTGGG + Intergenic
1057917933 9:99071928-99071950 CTGACTCAGGGCCTCCTTCTGGG - Intergenic
1058662514 9:107280032-107280054 CTGACTCAGCCCCTGTCTCATGG + Intergenic
1060743240 9:126113307-126113329 CTGACTCAGCTCAGGCCTCTGGG - Intergenic
1060812226 9:126616242-126616264 CTGAGTCAGCCCTTCCCACAAGG + Intronic
1061024833 9:128041770-128041792 CTGACTCAGCCCTGCCCTGAGGG + Intergenic
1061407508 9:130400613-130400635 CCCACTCAGCACATCCTTCTGGG - Intronic
1061587432 9:131578115-131578137 CTGCCCCAGCCCATGCCTCCGGG - Exonic
1062179027 9:135180748-135180770 CTGTTTCAGCCCTTCCCTCAGGG + Intergenic
1186430187 X:9498545-9498567 CTGGCCCAGCTCAGCCCTCTAGG - Intronic
1189145782 X:38653347-38653369 GTGACTCAGCCCATCACTTTTGG + Intronic
1190983539 X:55480143-55480165 CTGACTCAGCATTTCCTTCTAGG + Intergenic
1190984875 X:55491140-55491162 CTGACTCAGCATTTCCTTCTAGG - Intergenic
1192835773 X:74797859-74797881 CTTACTGAACCCATCTCTCTGGG - Intronic
1193540022 X:82759740-82759762 CTGACTCAGCCCAGGGGTCTAGG + Intergenic
1193789175 X:85797597-85797619 CTGGCCCTGCCCCTCCCTCTGGG + Intergenic
1194497122 X:94630452-94630474 CTGACTAAGCAGACCCCTCTGGG + Intergenic
1195734751 X:108000864-108000886 CTGAGTTGCCCCATCCCTCTTGG + Intergenic
1197446032 X:126552865-126552887 CTGCCTCCGCCCCTCCCACTCGG - Intergenic
1197446225 X:126553976-126553998 CTGCCTCAGCCCCTCCCGCTTGG - Intergenic
1199394476 X:147318460-147318482 CTGACTAATCCCAGCCCTGTTGG - Intergenic
1201247385 Y:12018737-12018759 ATGACTCAGGCCCTCCCTCTGGG + Intergenic