ID: 1162315905

View in Genome Browser
Species Human (GRCh38)
Location 19:9937699-9937721
Sequence ATGTAGGCAGAGGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162315892_1162315905 9 Left 1162315892 19:9937667-9937689 CCTCCCCACAGCCCCTCTAGGGA No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315897_1162315905 -2 Left 1162315897 19:9937678-9937700 CCCCTCTAGGGATTCGGATATAT No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315888_1162315905 23 Left 1162315888 19:9937653-9937675 CCCTAGTCGTCTTTCCTCCCCAC No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315889_1162315905 22 Left 1162315889 19:9937654-9937676 CCTAGTCGTCTTTCCTCCCCACA No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315893_1162315905 6 Left 1162315893 19:9937670-9937692 CCCCACAGCCCCTCTAGGGATTC No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315895_1162315905 4 Left 1162315895 19:9937672-9937694 CCACAGCCCCTCTAGGGATTCGG No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315898_1162315905 -3 Left 1162315898 19:9937679-9937701 CCCTCTAGGGATTCGGATATATG No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315899_1162315905 -4 Left 1162315899 19:9937680-9937702 CCTCTAGGGATTCGGATATATGT No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data
1162315894_1162315905 5 Left 1162315894 19:9937671-9937693 CCCACAGCCCCTCTAGGGATTCG No data
Right 1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162315905 Original CRISPR ATGTAGGCAGAGGTGGAGGA GGG Intergenic
No off target data available for this crispr