ID: 1162320608

View in Genome Browser
Species Human (GRCh38)
Location 19:9969075-9969097
Sequence GTGTAGACCATCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162320601_1162320608 21 Left 1162320601 19:9969031-9969053 CCATCAAGGTGGAGTATTAGAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG 0: 1
1: 1
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162320608 Original CRISPR GTGTAGACCATCAAGGTGGA AGG Intronic
905931745 1:41792760-41792782 GTGTATGCAATGAAGGTGGAGGG - Intronic
905932217 1:41797137-41797159 GTGTCCACCATCAAGGAAGATGG + Intronic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
914967817 1:152277146-152277168 GTGTGGAGGATCATGGTGGATGG + Intergenic
915509682 1:156379790-156379812 GTGTAAGCCAGCAAGGTGGGAGG - Intronic
915519523 1:156433519-156433541 ATATAGACCAGCAAGATGGATGG + Intergenic
922418335 1:225442294-225442316 TTGGAGAGCATCATGGTGGAGGG - Intergenic
923010808 1:230086073-230086095 GTGAATTCCATGAAGGTGGACGG - Intronic
1063882391 10:10544223-10544245 CTGTTGGCCATCCAGGTGGAAGG + Intergenic
1065552373 10:26881810-26881832 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1066580871 10:36880609-36880631 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1073626808 10:105106428-105106450 GTATAGACCATAAAGTTGCAAGG - Intronic
1077480373 11:2811784-2811806 GTGGAGACCACCAAAGAGGAGGG + Intronic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1085054343 11:73395139-73395161 GTGAAGACCATCACGGAGGCTGG + Exonic
1089774003 11:120823599-120823621 GTGCAGACCATGATGGTGGAAGG - Intronic
1091190256 11:133687787-133687809 GTGTACACCATCAAGCTGCAGGG + Intergenic
1091406650 12:213576-213598 GTGGTGCCCAGCAAGGTGGAAGG - Intronic
1094415660 12:30212338-30212360 GTGCAGAACATTAACGTGGAGGG + Intergenic
1112656885 13:101461034-101461056 CTCTAGATCATCAAGGTGCAGGG - Intronic
1118704482 14:68468214-68468236 GTCTACACCATCAAGGAGGAAGG + Exonic
1120480053 14:85038221-85038243 GTGTGGAACATCAAATTGGAGGG - Intergenic
1125929399 15:43589795-43589817 GGGGAGAGGATCAAGGTGGAAGG - Intronic
1125942566 15:43689627-43689649 GGGGAGAGGATCAAGGTGGAAGG - Intergenic
1137939881 16:52673625-52673647 GTGTAGACCAGCATGTGGGATGG - Intergenic
1138507234 16:57484462-57484484 GTGAGTCCCATCAAGGTGGATGG + Intronic
1141781240 16:86162925-86162947 GAGTAGAACAAAAAGGTGGAAGG - Intergenic
1143001332 17:3796993-3797015 GTGTAGAAGATCGAGGTGGGGGG - Intronic
1148324505 17:46775420-46775442 CTGGAGACAACCAAGGTGGATGG - Intronic
1151122543 17:71808696-71808718 GTGTGTACCAGCAAGGTGGCAGG - Intergenic
1155181593 18:23352912-23352934 GTGTGGACCAACAAGGGCGAGGG + Intronic
1155994096 18:32311888-32311910 GAGAAGACCATAAAGGTGCAAGG + Intronic
1156919642 18:42505158-42505180 GTGTTTACCCTCAAGGTGGATGG + Intergenic
1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG + Intronic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1162333590 19:10046271-10046293 GTGCATAGCATCAAGGTGAATGG + Intergenic
1165074099 19:33271220-33271242 ATGGAGACCATGAAGTTGGAGGG - Intergenic
1166357024 19:42233278-42233300 GTGGAGATCATCAAGGTGAGGGG - Exonic
925388566 2:3480591-3480613 AGGAAGACCCTCAAGGTGGAGGG - Intronic
926380778 2:12287100-12287122 GTGCAGGCCATCAATCTGGAAGG + Intergenic
928922169 2:36537501-36537523 GTTGAGCCCATCAACGTGGAAGG + Exonic
930378113 2:50593044-50593066 GAGCAGAGCATCAAGGTGAAGGG - Intronic
932936730 2:76112221-76112243 GTGCAGACAATCCATGTGGATGG - Intergenic
936963664 2:118104118-118104140 GTTTAGACAATGAAGGTGGCAGG + Intronic
939387019 2:141514150-141514172 GTGTAGTCCATGAGGGTTGAGGG - Intronic
945566159 2:211402812-211402834 GTTTAGAACATCAAGATGGATGG - Intronic
1169401176 20:5282111-5282133 GTGTCAATCATCATGGTGGACGG + Intergenic
1172619384 20:36309062-36309084 GTGAAGACCCTGAAGCTGGAGGG - Intronic
1174742145 20:53025545-53025567 GGGAAGTTCATCAAGGTGGAGGG - Intronic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1178081706 21:29073274-29073296 TTGTACACCTTGAAGGTGGACGG - Intronic
1179105743 21:38398665-38398687 GTATGGCCCATCCAGGTGGATGG - Intronic
1179217267 21:39378341-39378363 GCGTGGTCCATCCAGGTGGAAGG + Intergenic
1181036164 22:20170684-20170706 AGGTAGAACATCAAGGCGGAAGG + Intergenic
1181406897 22:22691391-22691413 GTTTTCACCATCAAGGTGAAGGG + Intergenic
1182499172 22:30733079-30733101 GTGTATCCCTCCAAGGTGGAAGG + Intronic
950603697 3:14058639-14058661 GAGTGGATCATCATGGTGGACGG - Intronic
956703004 3:71975187-71975209 ATGTTGACTATCAAGGTGGCCGG + Intergenic
957873394 3:86114817-86114839 GGGCAGAAAATCAAGGTGGATGG + Intergenic
963525986 3:146413991-146414013 GTGAAGTCCAAGAAGGTGGAAGG + Intronic
963844494 3:150141395-150141417 GTGTGGAGCTTAAAGGTGGAAGG - Intergenic
967351814 3:188522300-188522322 GTGTGTATCATCAAGCTGGACGG - Intronic
974074140 4:57153490-57153512 GTGAAGTCAATAAAGGTGGATGG + Intergenic
975760012 4:77610643-77610665 GTGTGGACCCTCAAGCTGAATGG + Exonic
978223257 4:106303295-106303317 GTGTAGAGTATCAAGGGGTATGG - Intronic
978697979 4:111606224-111606246 TGGTAGAACATCAAGCTGGAAGG + Intergenic
987577610 5:19751807-19751829 ATTTAATCCATCAAGGTGGATGG + Intronic
988598531 5:32617782-32617804 GTGAAGCCCATCAGGGTGGCTGG - Intergenic
989770505 5:45139356-45139378 GTAAAGACCTTCAAGATGGAAGG + Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
992120285 5:73585617-73585639 GTGGTGACCAACAAGGTGGGAGG + Intergenic
998132998 5:139660529-139660551 GTGTAGACCACAAAGGTGACTGG - Intronic
998278620 5:140783128-140783150 GTGGAAACCATCAAGGTTTATGG - Intergenic
1002475266 5:179461674-179461696 GTGTAGGGGATCAGGGTGGAGGG - Intergenic
1003584872 6:7379053-7379075 GAGTAGACCATGAACTTGGATGG + Intronic
1004850457 6:19693355-19693377 GGGTAGACAATGAAGGTGGAGGG + Intergenic
1006521810 6:34575204-34575226 CTGTAGACCCTCAAGGGGCAGGG - Intergenic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1018312684 6:162526947-162526969 GTGTAGACCATCAAGCACCAGGG + Intronic
1023981812 7:45074784-45074806 GTGTAGGACTTCAAGGCGGAAGG + Intronic
1027591888 7:80128631-80128653 GTGCAGGCCATTCAGGTGGAGGG - Intergenic
1030956928 7:115864493-115864515 CTGGAGAGAATCAAGGTGGATGG - Intergenic
1034498618 7:151436189-151436211 GTGAACACCATCAAGGTGTACGG - Exonic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1042069692 8:64917565-64917587 GTGTAGATCTTCAACCTGGAGGG - Intergenic
1044631415 8:94282593-94282615 GTGTAGAACATGCAGTTGGAAGG - Intergenic
1045203311 8:100010127-100010149 GTGTAGACATCCAAGATGGAAGG - Intronic
1045747489 8:105440749-105440771 CTGAAGACCATCAAGAAGGAAGG + Intronic
1049546473 8:143233999-143234021 GGGCAGAGCATGAAGGTGGATGG - Intergenic
1050980598 9:12008863-12008885 CTGTAGAACTGCAAGGTGGAAGG + Intergenic
1051720695 9:20034156-20034178 GTGTAGATAATCAAGCAGGAAGG - Intergenic
1055884194 9:81039867-81039889 GAATAGACCTTCAAGGGGGAAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057499760 9:95587412-95587434 GTGGTGACCAGCAAGGTGGGTGG - Intergenic
1061078399 9:128355481-128355503 GTGTCCACCACCGAGGTGGAAGG + Exonic
1188474398 X:30574606-30574628 TTGTAGCCCATGATGGTGGAAGG - Intronic
1190689013 X:52898080-52898102 CTGTACTCCAGCAAGGTGGACGG - Exonic
1190696970 X:52957712-52957734 CTGTACTCCAGCAAGGTGGACGG + Intronic
1195795306 X:108641362-108641384 GTGAGGATCATCATGGTGGACGG + Intronic
1196237087 X:113294620-113294642 GTGAAGGCCATGAAGATGGATGG - Intergenic