ID: 1162320625

View in Genome Browser
Species Human (GRCh38)
Location 19:9969177-9969199
Sequence GTGTAGACCATCAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162320625 Original CRISPR GTGTAGACCATCAGGGTGGA AGG Intronic
900098464 1:950683-950705 GTGTGCACCATCTGGGTGCATGG - Intronic
904992251 1:34602515-34602537 GGGTACACCATGGGGGTGGAGGG - Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
908238220 1:62167745-62167767 GTTTAAACCATGAGGGGGGAGGG - Intergenic
914393098 1:147239594-147239616 CTGTAGATGATCAGGATGGAAGG - Intronic
914967817 1:152277146-152277168 GTGTGGAGGATCATGGTGGATGG + Intergenic
921345989 1:214185617-214185639 GTCTTGACCATCGGGGTGAAGGG - Intergenic
922418335 1:225442294-225442316 TTGGAGAGCATCATGGTGGAGGG - Intergenic
924506304 1:244688277-244688299 TTGTAGATTATCAGGTTGGAAGG - Intronic
1065552373 10:26881810-26881832 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1066580871 10:36880609-36880631 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1075303104 10:121342913-121342935 ATGTAGACCATCGGGAAGGAGGG - Intergenic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1085054343 11:73395139-73395161 GTGAAGACCATCACGGAGGCTGG + Exonic
1087455631 11:98382842-98382864 CTGGATACCAGCAGGGTGGAAGG + Intergenic
1088723072 11:112611592-112611614 GTCTATACCATCTGGGTGGTAGG - Intergenic
1089774003 11:120823599-120823621 GTGCAGACCATGATGGTGGAAGG - Intronic
1091190256 11:133687787-133687809 GTGTACACCATCAAGCTGCAGGG + Intergenic
1092012237 12:5124068-5124090 GTCTAGACCAGCAGGGTATAAGG + Intergenic
1101080058 12:101172870-101172892 CTGTAAACCATCCGGGTGCAAGG + Intronic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1105438623 13:20397974-20397996 GTGTAGATCATGAGTGTGAAAGG - Intergenic
1108027950 13:46198484-46198506 GTGTATGCAATCAGGGTTGAGGG + Intronic
1109608731 13:64734887-64734909 CTGTACACCATCTGGGTGGCAGG - Intergenic
1111249091 13:85580088-85580110 ATGTAGACTAGCAGGCTGGAGGG + Intergenic
1117042242 14:51777995-51778017 GGGAAGACCATCAGGCTGGGTGG - Intergenic
1118704482 14:68468214-68468236 GTCTACACCATCAAGGAGGAAGG + Exonic
1122781994 14:104147612-104147634 GTGCAGCCCATCAGGGCGGGGGG - Intronic
1122795961 14:104206348-104206370 GAGTGGACCATCAGGGGGCAGGG + Intergenic
1127964672 15:63914658-63914680 AGGTAGAAAATCAGGGTGGAGGG - Intronic
1136022398 16:27448597-27448619 CTGTACACCTCCAGGGTGGAGGG - Exonic
1136025175 16:27464245-27464267 GTGAGGCCCATCAGGGCGGAGGG + Intronic
1137939881 16:52673625-52673647 GTGTAGACCAGCATGTGGGATGG - Intergenic
1138212186 16:55172989-55173011 GTGTGGACTTTCAGGGTAGAAGG - Intergenic
1139474733 16:67197494-67197516 GTGTGGAGCCTCAGGGTGGGTGG + Intronic
1142029134 16:87829735-87829757 GTGGAGACCACCGGGGAGGAGGG - Intergenic
1144702038 17:17346457-17346479 GTGTAAGCCATCAGGATGGCAGG + Intronic
1147882556 17:43663336-43663358 TTGTAGACCAGTAGAGTGGATGG + Intergenic
1148002978 17:44400973-44400995 ATGAAGACCCTCAGGATGGAGGG - Exonic
1152730637 17:81967951-81967973 GTGGGGACCAGCAGGCTGGACGG - Intergenic
1153395775 18:4618900-4618922 CTGTAAACCATCTGAGTGGAAGG - Intergenic
1156319084 18:36001233-36001255 GTTTTGACCTTGAGGGTGGAAGG + Intronic
1156919642 18:42505158-42505180 GTGTTTACCCTCAAGGTGGATGG + Intergenic
1157804681 18:50649393-50649415 GTGCAAACCTTCTGGGTGGAAGG - Intronic
1157997631 18:52578096-52578118 GTGTAAATAATCAGGTTGGAAGG - Intronic
1159768644 18:72521976-72521998 GAGGAGAACAACAGGGTGGAGGG - Intergenic
1160815485 19:1033839-1033861 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815520 19:1033979-1034001 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815642 19:1034471-1034493 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815659 19:1034541-1034563 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1160815676 19:1034611-1034633 GTGTAGACCGGCAGCGTGGGTGG + Intronic
1161705522 19:5819069-5819091 GTGTGGGCAAGCAGGGTGGAGGG + Intergenic
1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG + Intronic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1162915009 19:13869929-13869951 GTGAAGTCCCTCAGGGTGGGAGG - Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164774961 19:30845720-30845742 CTGTAGACCTTCTGGGTGAAGGG + Intergenic
929061748 2:37931537-37931559 GTATAGACCAAAAGGGTGAATGG + Intronic
929433003 2:41904419-41904441 GTGTAGATGATCAGGTTGGTTGG + Intergenic
936255586 2:110908047-110908069 ATGTAGAGCATCAGGCTGCAAGG + Intronic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938293366 2:130162030-130162052 GTCCAGACTATGAGGGTGGAGGG - Intronic
938463186 2:131510931-131510953 GTCCAGACTATGAGGGTGGAGGG + Intergenic
939387019 2:141514150-141514172 GTGTAGTCCATGAGGGTTGAGGG - Intronic
941977920 2:171425359-171425381 GCATAGTCCATCAGTGTGGATGG + Intronic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
945566159 2:211402812-211402834 GTTTAGAACATCAAGATGGATGG - Intronic
946280458 2:218662378-218662400 GTGTGGAACATCAGGGTGTGAGG + Intronic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
947720725 2:232367922-232367944 GTGAAGCCCTCCAGGGTGGAAGG + Intergenic
1169401176 20:5282111-5282133 GTGTCAATCATCATGGTGGACGG + Intergenic
1177814499 21:25961098-25961120 GGGTAGACAATCAGGGTGATTGG - Intronic
1178430778 21:32517041-32517063 TTGCAGACCATAAGGGTGAAGGG + Intergenic
1179835176 21:44026849-44026871 GAGAAGACCCTGAGGGTGGAGGG - Intronic
1180571523 22:16726648-16726670 GTGTTGACAAACAGGGTGCATGG - Intergenic
1181292358 22:21805866-21805888 GTGTTGAGCAGCAGGTTGGAAGG + Exonic
950603697 3:14058639-14058661 GAGTGGATCATCATGGTGGACGG - Intronic
953009488 3:39011147-39011169 CTGTAAACCATCAGGGAGGTCGG - Intergenic
957106669 3:75897819-75897841 GTGTTGACAAACAGGGTGCATGG + Intergenic
961693625 3:128688645-128688667 GTGGAGAACATTAGAGTGGAAGG - Intergenic
961861252 3:129918241-129918263 CTGCAGACCATCAGGGTTGTCGG + Intergenic
963068085 3:141279737-141279759 GTGAAAAACATCAGGGTGGGAGG - Intronic
963526164 3:146416551-146416573 GTGTAGACAACCAGGGTCGTAGG + Intronic
967965534 3:194957302-194957324 GGGGAGACCACCAGGGTGTAAGG + Intergenic
978077327 4:104548974-104548996 CTCTAGAACACCAGGGTGGAAGG + Intergenic
979991853 4:127384152-127384174 GTGTAAAACAGCAGTGTGGAAGG + Intergenic
981815661 4:148828255-148828277 GTCTACACCAACAGTGTGGAGGG + Intergenic
988598531 5:32617782-32617804 GTGAAGCCCATCAGGGTGGCTGG - Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
995736257 5:115303068-115303090 GTGGAGGCCATCAGTGTAGATGG + Intergenic
999153345 5:149441372-149441394 CTGGAGGCCACCAGGGTGGAGGG + Intergenic
1002475266 5:179461674-179461696 GTGTAGGGGATCAGGGTGGAGGG - Intergenic
1004850457 6:19693355-19693377 GGGTAGACAATGAAGGTGGAGGG + Intergenic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1010133040 6:72517792-72517814 GATTAGAAAATCAGGGTGGATGG - Intergenic
1012512758 6:100023116-100023138 GTCTACCCCATCAGGGAGGAAGG + Intergenic
1013616778 6:111850792-111850814 GTGGAGACCCTGAGCGTGGATGG - Intronic
1014274114 6:119367422-119367444 CTGGAGCCTATCAGGGTGGAGGG + Intergenic
1018632849 6:165835514-165835536 GCTTAGACCAGCAGGGAGGAAGG - Intronic
1018934010 6:168261434-168261456 GGGGAGACCACCAGGGTGGGAGG + Intergenic
1019257926 7:63495-63517 GTGTAGGCCATCGGGTGGGATGG + Intergenic
1019470086 7:1214848-1214870 ATGAAGCCCATCAGGATGGAAGG + Intergenic
1022387964 7:29919138-29919160 GTCTAGATCATCAGAGTGGCTGG - Intergenic
1024177064 7:46851389-46851411 GTGTAGACTGTCAGGTTGGGAGG + Intergenic
1030345976 7:108433268-108433290 GTGTACACCCACAGGCTGGAGGG - Intronic
1032906029 7:136367791-136367813 GTATAAACCTTCTGGGTGGAAGG + Intergenic
1033551729 7:142453502-142453524 TTATAGACCCTCTGGGTGGAGGG - Intergenic
1034498618 7:151436189-151436211 GTGAACACCATCAAGGTGTACGG - Exonic
1035767136 8:2115486-2115508 CTGTGGTCCATCAGGGTGCAGGG - Intronic
1037942485 8:22962890-22962912 GAGTGGACCACCTGGGTGGATGG + Intronic
1039929802 8:41974806-41974828 ATGTAGACAATCAGGATGGCTGG - Exonic
1051678249 9:19580361-19580383 GTGTAATCCTTCAGGGTGGTGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059762415 9:117351041-117351063 GTGTAGACGTTGAGGGTGCAAGG - Intronic
1062011998 9:134272377-134272399 GTGCAGAACATAAGGGGGGAAGG + Intergenic
1188474398 X:30574606-30574628 TTGTAGCCCATGATGGTGGAAGG - Intronic
1189704133 X:43743070-43743092 ATGAAGGCCATCAGGGTGGGGGG + Intronic
1193921672 X:87435605-87435627 GTCTTGATCAACAGGGTGGATGG - Intergenic
1195429729 X:104775240-104775262 CTGTCTACAATCAGGGTGGATGG + Intronic
1195795306 X:108641362-108641384 GTGAGGATCATCATGGTGGACGG + Intronic
1196620435 X:117816476-117816498 GTGTAATCCATCAGGGTAAATGG - Intergenic