ID: 1162321071

View in Genome Browser
Species Human (GRCh38)
Location 19:9970815-9970837
Sequence CAAGCTGCTCACATTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 251}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162321060_1162321071 -2 Left 1162321060 19:9970794-9970816 CCCACCTCCCACCTACTCCCTCA 0: 1
1: 1
2: 5
3: 109
4: 1052
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321055_1162321071 20 Left 1162321055 19:9970772-9970794 CCTCACCCCAGCACCGGGTACTC 0: 1
1: 0
2: 0
3: 18
4: 245
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321050_1162321071 27 Left 1162321050 19:9970765-9970787 CCCCAAGCCTCACCCCAGCACCG 0: 1
1: 0
2: 0
3: 37
4: 354
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321059_1162321071 7 Left 1162321059 19:9970785-9970807 CCGGGTACTCCCACCTCCCACCT 0: 1
1: 1
2: 3
3: 54
4: 513
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321056_1162321071 15 Left 1162321056 19:9970777-9970799 CCCCAGCACCGGGTACTCCCACC 0: 1
1: 0
2: 0
3: 13
4: 156
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321062_1162321071 -6 Left 1162321062 19:9970798-9970820 CCTCCCACCTACTCCCTCAAGCT 0: 1
1: 1
2: 2
3: 40
4: 374
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321053_1162321071 25 Left 1162321053 19:9970767-9970789 CCAAGCCTCACCCCAGCACCGGG 0: 1
1: 0
2: 3
3: 30
4: 424
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321057_1162321071 14 Left 1162321057 19:9970778-9970800 CCCAGCACCGGGTACTCCCACCT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321051_1162321071 26 Left 1162321051 19:9970766-9970788 CCCAAGCCTCACCCCAGCACCGG 0: 1
1: 0
2: 1
3: 22
4: 291
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321064_1162321071 -10 Left 1162321064 19:9970802-9970824 CCACCTACTCCCTCAAGCTGCTC 0: 1
1: 1
2: 2
3: 37
4: 356
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321061_1162321071 -3 Left 1162321061 19:9970795-9970817 CCACCTCCCACCTACTCCCTCAA 0: 1
1: 0
2: 17
3: 133
4: 1010
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321063_1162321071 -9 Left 1162321063 19:9970801-9970823 CCCACCTACTCCCTCAAGCTGCT 0: 1
1: 0
2: 0
3: 15
4: 260
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251
1162321058_1162321071 13 Left 1162321058 19:9970779-9970801 CCAGCACCGGGTACTCCCACCTC 0: 1
1: 0
2: 1
3: 5
4: 134
Right 1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG 0: 1
1: 0
2: 0
3: 28
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162321071 Original CRISPR CAAGCTGCTCACATTCCTGG GGG Intronic
900197867 1:1386217-1386239 CAAGGTGCTCTCGTTCCTGAGGG - Intronic
900776993 1:4592980-4593002 CACGGAGCTCACATTCCAGGGGG - Intergenic
901167932 1:7233067-7233089 CAAGCTTCTCACATTCTGGTGGG - Intronic
903447847 1:23433625-23433647 CCAGCTCCTCACACTCCTTGTGG + Exonic
903842608 1:26254691-26254713 CTCGTTGCTCACCTTCCTGGGGG + Intronic
905516924 1:38568864-38568886 CAGGCTGCAGATATTCCTGGAGG + Intergenic
906685737 1:47761974-47761996 TAAGCTGCTCACAGTCCGAGAGG + Exonic
906708042 1:47909330-47909352 CAGGCTGCTTCCACTCCTGGCGG + Intronic
907295116 1:53446007-53446029 CAAGCTGCTTCCATTCATGGTGG + Intergenic
908210157 1:61892171-61892193 CCAGTTGCTCACATTCCCTGTGG + Intronic
909784080 1:79587784-79587806 TAAGCAGCTCACTTTCCTTGAGG - Intergenic
909866112 1:80673991-80674013 CAAGTAGCTCACATTTCTGCTGG + Intergenic
910458193 1:87420877-87420899 CAAGCTGCTCACAGCCAGGGAGG - Intergenic
912564070 1:110572600-110572622 CAAGCTGTGCACCTTCCAGGTGG - Intergenic
913069293 1:115284883-115284905 CAGGTTGCTAACTTTCCTGGAGG + Intergenic
915164521 1:153941215-153941237 CAATCTGATCACATACCTGAGGG + Exonic
915798819 1:158766538-158766560 AAACCTGCTGATATTCCTGGTGG - Exonic
916398163 1:164414360-164414382 CAAGTTGCTCTCCTTCCTGGAGG - Intergenic
916898725 1:169196760-169196782 CAAGCTGCTCACATAACATGAGG + Intronic
917541872 1:175922312-175922334 CAGGCTGCTTCCATTCATGGTGG + Intergenic
918130537 1:181624029-181624051 CAAGCTGCTCCCACTCATGGTGG + Intronic
922579958 1:226689493-226689515 CAAGATGCTCACTATCCGGGTGG + Intronic
923617108 1:235547149-235547171 CACTCTGCTCACATCCCTGGGGG - Intergenic
924235446 1:241996190-241996212 AAGGCTGCTCCCATCCCTGGGGG + Exonic
1063286558 10:4694822-4694844 CAGGCTGCTCCCAGTCCTGGTGG - Intergenic
1064246279 10:13669900-13669922 CATCCTGCACACATTCTTGGAGG + Intronic
1068100586 10:52547677-52547699 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1068243985 10:54341120-54341142 CGATCAGCTGACATTCCTGGGGG + Intronic
1069087393 10:64157341-64157363 CTAGCTGCTTGCATTCCTGTGGG + Intergenic
1070052728 10:72904936-72904958 CAGGCTGCTCCCACTCATGGAGG + Intronic
1072293127 10:93984757-93984779 CAAGCTACTCAAATTCCTTTGGG - Intergenic
1072800739 10:98390722-98390744 CAGGCTGCCCAGCTTCCTGGCGG - Exonic
1073101005 10:101006706-101006728 GCAGCTGCTCAGCTTCCTGGCGG - Exonic
1074448386 10:113539100-113539122 CATGAGGCTCACATTCCTGCAGG + Intergenic
1074597998 10:114885064-114885086 CATACTGCCCACCTTCCTGGGGG + Intronic
1074650969 10:115524014-115524036 CAAGCTGTTTCCATTCATGGTGG + Intronic
1074728905 10:116347384-116347406 CAATCTGCTCCCTTTCCTGAAGG - Intronic
1074959804 10:118433015-118433037 CAAGAAGCTCACAATCATGGTGG + Intergenic
1074990664 10:118703677-118703699 CAAGCTTCTCACACTTTTGGTGG - Intronic
1075354732 10:121761150-121761172 CAAGCTGCTCCCACCCATGGTGG - Intronic
1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG + Intergenic
1076138582 10:128062373-128062395 CCAGCTGGGCACATTCCTGATGG - Intronic
1076204933 10:128589599-128589621 GAAGATGCTTTCATTCCTGGTGG - Intergenic
1078093936 11:8284940-8284962 CAAGTTGCCCACAATCTTGGGGG - Intergenic
1078709436 11:13776652-13776674 CAGGCTGGTCACAGTCCTGCTGG - Intergenic
1079259028 11:18860075-18860097 CCTGCTGCTGAAATTCCTGGAGG - Intergenic
1083373542 11:62201553-62201575 AAAGATGCCCACATTCCTGCTGG + Intergenic
1085381340 11:76121924-76121946 CAAGCTGCTCAAAAGCCTAGTGG - Intronic
1086401745 11:86466463-86466485 CAAGCTGCTCCCAAGCCTGTAGG - Intronic
1086791241 11:91040918-91040940 CATGCAGCTCACATTCCCAGTGG + Intergenic
1086874915 11:92083993-92084015 CAGGCTGCTTCCATTCCTAGCGG - Intergenic
1086963592 11:93005539-93005561 CAAGCTGCTCCCAGTCCTCTGGG + Intergenic
1087005272 11:93464585-93464607 GAAACTGATCACATTGCTGGTGG + Intergenic
1087974814 11:104531653-104531675 CAGGGAGCTCACAATCCTGGAGG + Intergenic
1088425310 11:109695875-109695897 CAAGTTGCTCAGATTCCCAGTGG - Intergenic
1088589440 11:111390722-111390744 CAAGATGCTCAGAGTCCTGTTGG - Intronic
1088638783 11:111850889-111850911 GAAACTGATCACTTTCCTGGGGG - Intronic
1089219935 11:116862312-116862334 GCAGCTGCTCACACTCCTGAAGG + Exonic
1089865103 11:121624726-121624748 CAAACTGTTCAGATTCTTGGTGG + Intronic
1090040791 11:123289568-123289590 CAAGCTGCTTCCAGTCATGGCGG + Intergenic
1090481151 11:127069763-127069785 CAAGTAGCTCACATTCCTGAAGG - Intergenic
1090709537 11:129373262-129373284 CCAGCGGCTCACTTTCCTCGGGG + Intergenic
1091586914 12:1821842-1821864 CAAGCTGTCCACATTTCTGGGGG + Intronic
1095837016 12:46649701-46649723 CAGGCTGCTCACACTCATGGTGG - Intergenic
1098437224 12:70480847-70480869 CAAGCAGCTCACAGTCCAGCAGG + Intergenic
1099963426 12:89418760-89418782 CAAGCTGCTTTCACTCATGGTGG - Intergenic
1100244115 12:92739324-92739346 CAAGCTGATCTCATTCCCAGGGG - Intronic
1100537927 12:95528248-95528270 CAAGGTGCTTACATTCCTAATGG - Intronic
1102673145 12:114637170-114637192 CAAGGGGCTCACAGTCCTGAGGG + Intergenic
1103164088 12:118755352-118755374 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1104973454 12:132541676-132541698 CCAGCTGCTCTCAGCCCTGGGGG + Intronic
1106899527 13:34340607-34340629 CAGGCTGCCCACACTCATGGTGG + Intergenic
1107444273 13:40456635-40456657 CCAGCTGTTCTCATTACTGGTGG - Intergenic
1110002994 13:70229419-70229441 CAAGCTGCTTCCACTCATGGTGG - Intergenic
1110484225 13:76019482-76019504 CATGCTGCTCATACTCCTGGAGG + Intergenic
1111687968 13:91525103-91525125 CAAGCTGCACACATTCTACGAGG - Intronic
1112361770 13:98725149-98725171 CAGGCTGCTTCCATTCATGGAGG - Intronic
1112499973 13:99935234-99935256 AAAGCTGCTCACACTCCAAGGGG - Intergenic
1113642915 13:111971018-111971040 GTGTCTGCTCACATTCCTGGGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114705664 14:24724295-24724317 CAAGTTGCACAGAATCCTGGTGG - Intergenic
1115093549 14:29607432-29607454 CAAGCTGCTCTCTTATCTGGAGG + Intronic
1115282721 14:31682917-31682939 CAGGCTGCTCCCACTCATGGTGG + Intronic
1115314638 14:32013192-32013214 CATGCTGATCCCATTCCTGGCGG + Intronic
1116325390 14:43527387-43527409 CAAACTGCTGAAAGTCCTGGAGG + Intergenic
1118851759 14:69589150-69589172 CATCCTGCTCACTGTCCTGGTGG - Intergenic
1119446974 14:74673167-74673189 TAAGCTGCTCACACTGGTGGTGG - Exonic
1119616425 14:76101902-76101924 CTAGCTGCTTCCCTTCCTGGTGG + Intergenic
1120820749 14:88909948-88909970 AAAGCTGCTAACATCCCTGCAGG + Intergenic
1121627053 14:95393534-95393556 CAAGCTGCCCAGAAGCCTGGGGG + Intergenic
1122118039 14:99537336-99537358 CAGGCTGTTAACATGCCTGGGGG + Intronic
1122182040 14:99962373-99962395 CAGGCTGCTTGCATTCATGGTGG - Intergenic
1122313521 14:100812322-100812344 CAAGCTGGTCACTTCCCTTGGGG + Intergenic
1122921418 14:104881948-104881970 CCAGCTGCTTACACTGCTGGGGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124707680 15:31978832-31978854 CAATCTGCTGAGATTCCAGGAGG - Intergenic
1127199728 15:56631559-56631581 CAAACAGATGACATTCCTGGAGG - Exonic
1128708279 15:69853124-69853146 GCAGCTGCCCACATACCTGGGGG + Intergenic
1128994661 15:72287775-72287797 CTAGCTGGCCACATTCCTGGTGG + Intronic
1129095726 15:73205505-73205527 CAACCTGGTAAAATTCCTGGAGG + Intronic
1129385602 15:75194605-75194627 CAAGCTTCCCACATTGCAGGGGG - Intergenic
1131991982 15:98101742-98101764 CCAGTTTCTCATATTCCTGGAGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1132558683 16:583835-583857 CAGGCCACTCACACTCCTGGGGG - Exonic
1133256519 16:4519844-4519866 CAGGCTGCTTCCATTCATGGTGG - Intronic
1133712369 16:8413769-8413791 CAAGCTGGGCACATCACTGGAGG - Intergenic
1133898639 16:9952419-9952441 TAAGCTGCTCACATTCCCAGTGG - Intronic
1134083149 16:11338338-11338360 CAGGCTGCTCATAGTTCTGGAGG + Intronic
1136049322 16:27639227-27639249 CAAGCCCCTCAGATTCCTGGGGG + Intronic
1137861968 16:51855901-51855923 CAAGCAGCTGTTATTCCTGGGGG - Intergenic
1138652215 16:58467028-58467050 CAAGCAGGTCACAGTCCGGGAGG + Intronic
1140628451 16:76822804-76822826 CAAGCTGCTGCCACTACTGGTGG + Intergenic
1141249735 16:82344368-82344390 AGAGCTGCACACACTCCTGGTGG - Intergenic
1141773511 16:86106170-86106192 CAGGCTCCTCACGCTCCTGGCGG - Intergenic
1143184754 17:5003519-5003541 CCAGCTGCCCACATTCCTGCTGG + Intronic
1143674032 17:8417678-8417700 CAGGCTGCTAACATTCTAGGGGG + Intronic
1144734627 17:17548203-17548225 CAAGCTGCACACAGCCCTGCTGG + Intronic
1149313639 17:55420458-55420480 CAAGCTGATCCCCTTCCTGGTGG + Intronic
1151451752 17:74202418-74202440 CAGGCTGAGCACCTTCCTGGGGG - Intergenic
1151819500 17:76490014-76490036 CAAGCTCCTCAGAGGCCTGGGGG + Intronic
1152132673 17:78486491-78486513 CCAGCTGCTCACCACCCTGGGGG + Exonic
1152147237 17:78575690-78575712 CAAGCTGCTCAGATGCTCGGGGG + Intronic
1153950091 18:10051285-10051307 AGAGGTGCTCTCATTCCTGGAGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1157904673 18:51558974-51558996 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1158855839 18:61542756-61542778 CAAGCTGCTTCCATGCATGGAGG + Intronic
1160305307 18:77728530-77728552 CAGGCTGCTCCCACCCCTGGTGG + Intergenic
1160449820 18:78954992-78955014 CAGGCTGCTCCCCTGCCTGGTGG - Intergenic
1161060056 19:2210381-2210403 CAACCTGCTCTCCTTCCAGGAGG + Exonic
1161194388 19:2978005-2978027 CCAGCTGCCCAGATTCATGGGGG - Intronic
1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG + Intronic
1164890766 19:31821315-31821337 GAAGCAGGTCACATCCCTGGGGG + Intergenic
1165675803 19:37721629-37721651 GTAGCTTCTCACATTCTTGGTGG - Intergenic
1166494108 19:43286044-43286066 TAAGCTACTTACATGCCTGGCGG + Intergenic
1166560374 19:43728922-43728944 CAAGCAGCAGGCATTCCTGGTGG + Exonic
1168198242 19:54791568-54791590 CATGATGCTCACATTGCTGTGGG + Intronic
1168228763 19:55015274-55015296 GATGCCGCTCACTTTCCTGGAGG + Intronic
925040329 2:727942-727964 CAGGCTGCTCTCAGTCCTGTGGG + Intergenic
925237874 2:2294878-2294900 CAAGAAGCTAACATTCCGGGTGG + Intronic
926613541 2:14971898-14971920 CAAGCTGTATCCATTCCTGGTGG + Intergenic
928436958 2:31260932-31260954 CAAGCTGCCCACCTCCCAGGGGG - Intronic
928705029 2:33940397-33940419 CAGACTGCTGCCATTCCTGGTGG - Intergenic
932338342 2:70943658-70943680 CACGCTGCACACAGTCCTGTAGG - Exonic
933967653 2:87443057-87443079 CAAACTGCACCCTTTCCTGGGGG - Intergenic
935368824 2:102323515-102323537 CAGGCTGCTTCCAATCCTGGTGG + Intronic
935822633 2:106909400-106909422 CAAGCTGCTTCCACTCATGGCGG - Intergenic
936236580 2:110747581-110747603 TAAGCTGATCACTTTCCTGGAGG + Intronic
936326146 2:111507439-111507461 CAAACTGCACCCTTTCCTGGGGG + Intergenic
937211453 2:120275014-120275036 CAGGCTGCTCATAGTGCTGGAGG - Intronic
937233967 2:120419293-120419315 CAGGGTCCTCACACTCCTGGGGG - Intergenic
937282006 2:120724317-120724339 CAAGCTGCTTCCATTTATGGTGG + Intergenic
938201544 2:129376757-129376779 CAGGCGACTCACACTCCTGGAGG + Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938606815 2:132902716-132902738 GAAGCTGCTCTCATGGCTGGTGG + Intronic
941176288 2:162201247-162201269 CAAACTTTTCACATTCGTGGGGG - Intronic
941589689 2:167404103-167404125 CAAGCTGCTTCCACTCATGGTGG + Intergenic
942082389 2:172412959-172412981 CAAGCTGCCAAGATTTCTGGTGG - Intergenic
942108580 2:172657927-172657949 CAGGCTGCTTCCACTCCTGGTGG + Intergenic
942518954 2:176782851-176782873 CAAGCTGTTCCCACTCATGGTGG - Intergenic
945500119 2:210562043-210562065 CAAGTTGTTCAGAATCCTGGAGG - Intronic
945507486 2:210659272-210659294 CAGGCTGCTTCCATTCATGGTGG + Intronic
947468539 2:230377754-230377776 GAAGCTTCACACATTACTGGTGG - Intronic
947789578 2:232856727-232856749 CAAGCGGCTCAAATTCTAGGCGG - Intronic
1169067795 20:2704266-2704288 CAAGCAGGGTACATTCCTGGAGG + Intronic
1169670657 20:8097396-8097418 AAAGCTGTACACATTGCTGGTGG - Intergenic
1169954640 20:11087726-11087748 CAAGCTGCTTGCACTCATGGTGG + Intergenic
1170184548 20:13573414-13573436 CAAGTTTCTCACAGTCCTGAAGG - Intronic
1172960372 20:38794915-38794937 CAATTTCCTCACATTTCTGGGGG + Intergenic
1173969495 20:47140857-47140879 CAAGCTGCTTCCATTCATGGTGG + Intronic
1175441993 20:58998871-58998893 CAAGGTGCTCATGTTCCTGGGGG - Intronic
1175741073 20:61420162-61420184 GCAGCTGCTCACACTCCTGAGGG - Intronic
1175780617 20:61680000-61680022 CAGGCTCCTCAGCTTCCTGGGGG - Intronic
1176048334 20:63103856-63103878 CAGGCCCCTCACACTCCTGGGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178048421 21:28722107-28722129 CAATATCCTCACATTCATGGTGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181417335 22:22770178-22770200 CGAGGTGCTCAGATTCCTGATGG - Intronic
1183230483 22:36578900-36578922 CAAGCTGTTCACAGTCCGTGGGG + Intronic
1184673071 22:46025820-46025842 GAAGCTGCTCATACTCCTTGAGG + Intergenic
1185219844 22:49623811-49623833 CAAGCTGGTCCCATGCCTGGGGG + Intronic
950021826 3:9792870-9792892 GAAGCTGCACCCATTCCTGGAGG + Intronic
950216563 3:11163948-11163970 CAAGCTGCTCACAGCCATGGGGG - Intronic
950269281 3:11600793-11600815 CAAGATGCTCCAATTCCTGAGGG - Intronic
950709738 3:14805727-14805749 CATGCTGCACACATTGCTGGAGG - Intergenic
950863426 3:16170450-16170472 CAAGCTGCTTCCATTCATGGTGG + Intergenic
954101169 3:48373722-48373744 CAAGCTGCTCATGTTCCTCTAGG - Intronic
955141991 3:56278715-56278737 CATGCTGCTTCCACTCCTGGTGG + Intronic
957322362 3:78648557-78648579 CTATCTTCTCCCATTCCTGGGGG + Intronic
958689737 3:97448561-97448583 TCAGCTGCTCATGTTCCTGGGGG - Exonic
958720141 3:97833895-97833917 CAAGCTGCTTCCACTCATGGTGG + Intronic
960053306 3:113258037-113258059 AAATCTGTTCACATTTCTGGCGG - Intronic
961639559 3:128356685-128356707 CACCCTGCTCCCTTTCCTGGAGG + Intronic
964137561 3:153362020-153362042 CAGGCTGCACACAAGCCTGGTGG + Intergenic
965482791 3:169240963-169240985 GCAGCTACTCACATTGCTGGTGG - Intronic
965785712 3:172332455-172332477 CAAGAAGCTCACATTCCAGTGGG - Intronic
965796734 3:172448212-172448234 CAACCTGCTCACCATGCTGGTGG - Exonic
967862415 3:194161964-194161986 CTAGTTGCTCACAGTCCAGGAGG + Intergenic
972939241 4:44177288-44177310 CCAGATCATCACATTCCTGGGGG - Intronic
973660406 4:53099559-53099581 CATGCTGCTTCCATTCATGGTGG + Intronic
973707038 4:53591429-53591451 CAGGCAGCTCTCATTCCTTGTGG + Exonic
974560781 4:63514560-63514582 TAAGCTGGTCAAGTTCCTGGAGG - Intergenic
980532119 4:134070107-134070129 CACACAGCACACATTCCTGGAGG - Intergenic
981041618 4:140228030-140228052 CAGGCTGCTCTCATTTATGGTGG - Intergenic
982827808 4:160022332-160022354 TAAGAGGCTCAGATTCCTGGAGG - Intergenic
983914202 4:173273822-173273844 TAAGCTGCTCAAAGTCCTTGTGG + Intronic
985673675 5:1219337-1219359 AGAGCTGCTCACATGCCCGGCGG - Intronic
986354582 5:6911144-6911166 AAAGATGAGCACATTCCTGGGGG + Intergenic
987336251 5:16900520-16900542 AAAGCTGCTCACCTCCCTGCTGG - Intronic
988420567 5:31000569-31000591 AAGGCTGCTCCCATTCATGGTGG - Intergenic
990754693 5:59055867-59055889 CAAGCTTCTCGTATTACTGGTGG - Intronic
992000383 5:72430429-72430451 CAAGCTGCTTCCACTCATGGTGG - Intergenic
992167406 5:74068334-74068356 CACTCTGCTCACATTCCAGTGGG + Intergenic
992391975 5:76337948-76337970 CAAGCTGGTCACTGTCTTGGAGG - Intronic
993178811 5:84521630-84521652 CAGGCTGCTTCCATTCATGGTGG - Intergenic
993599583 5:89904238-89904260 CAAGCTGTTCAAATTACTGATGG + Intergenic
998328887 5:141305930-141305952 CACGCTCCTCACTTTCCTGGGGG + Intergenic
999193001 5:149762671-149762693 CAAGGTGCTCACTGTTCTGGAGG + Intronic
1003219436 6:4145586-4145608 CAGGCTGCTTCCATTCCTGGTGG + Intergenic
1004307652 6:14515577-14515599 AAAGCTTCTCACATTCCCGTGGG - Intergenic
1005019325 6:21402422-21402444 CAGGCTGCCCAGAGTCCTGGGGG + Intergenic
1005595086 6:27371179-27371201 CAAGTTGCTTCCATTCATGGTGG - Intergenic
1006429250 6:33985034-33985056 GCAGCTGCTCACTTTCCTAGCGG + Intergenic
1006604138 6:35244136-35244158 TAAGCTACTCACCTCCCTGGGGG + Intronic
1007227357 6:40324573-40324595 GAAGCTGGTCGCCTTCCTGGGGG + Intergenic
1007619353 6:43202713-43202735 CAGGCAGCTCACTTTGCTGGTGG + Exonic
1008671281 6:53771862-53771884 CAAGCTGCTTTCACTCATGGAGG + Intergenic
1009314747 6:62204053-62204075 CAAGCTGCTTCCACTCATGGTGG - Intronic
1010703622 6:79079894-79079916 CTAGCTCCTTACATTCCTAGTGG + Intergenic
1011709457 6:90037516-90037538 CAAGGTGCTAACACTCTTGGTGG + Intronic
1012224297 6:96687083-96687105 CAAGCTGCATACTTTCCTGTGGG + Intergenic
1012280572 6:97323004-97323026 CAAGCTGCCATCATTTCTGGAGG + Intergenic
1016100147 6:140089917-140089939 AAATCTGTTCACAGTCCTGGAGG + Intergenic
1016560702 6:145392573-145392595 CAAGTTGCTCAAATTACAGGGGG + Intergenic
1017332342 6:153214530-153214552 CCTGCTGCTCTCATTCCTGTAGG - Intergenic
1017646430 6:156543554-156543576 CAAGCTGCCTCCACTCCTGGTGG - Intergenic
1018006162 6:159624038-159624060 CAAGAGGCTCACAATCATGGCGG - Intergenic
1018377613 6:163228195-163228217 AGAGCTGGTCAAATTCCTGGAGG - Intronic
1018595044 6:165470131-165470153 CAGGCTGCTTCCACTCCTGGAGG + Intronic
1019543206 7:1560650-1560672 CACGCAGCTCACCTCCCTGGTGG + Intronic
1022348027 7:29537404-29537426 CAAGGTGTTCACATTCCTGTAGG - Intergenic
1022818364 7:33934988-33935010 CAAGCAGCATACATACCTGGTGG + Intronic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1029263518 7:99320700-99320722 CCAGCTCCTCTCATCCCTGGAGG - Intergenic
1034693843 7:153036648-153036670 GAAGTTGCATACATTCCTGGTGG - Intergenic
1035030494 7:155854179-155854201 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1036285773 8:7443170-7443192 CAAGCTGCTCACTGTCCTCCTGG - Intronic
1036335700 8:7868359-7868381 CAAGCTGCTCACTGTCCTCCTGG + Intronic
1039887384 8:41662706-41662728 CAAGCAGCTCACAGTGCAGGAGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040587301 8:48756125-48756147 CGGGCTGCTCCCATTCCCGGTGG + Intergenic
1041304848 8:56447670-56447692 CAAGCTGCTTACATTGCCTGAGG + Intergenic
1041451144 8:58007756-58007778 CAAATTTCTCACAGTCCTGGAGG - Intronic
1044186103 8:89253948-89253970 CCACCTGGTTACATTCCTGGTGG - Intergenic
1047102936 8:121699084-121699106 CTGGCTGCCCACATTGCTGGTGG - Intergenic
1049296838 8:141845287-141845309 CAACCTGATCACATGGCTGGGGG - Intergenic
1050012403 9:1198501-1198523 CATGATGATCACATTCTTGGAGG + Intergenic
1050615976 9:7402238-7402260 CAGCCAGCTCACATTCCTGTTGG - Intergenic
1050868350 9:10533169-10533191 CAGGCTGCTTCCACTCCTGGAGG - Intronic
1052681772 9:31701829-31701851 CCTGTTGTTCACATTCCTGGTGG - Intergenic
1052880845 9:33600148-33600170 CAAGCTGCCAGGATTCCTGGAGG - Intergenic
1053056397 9:34995395-34995417 TAAGGGGCTCAGATTCCTGGAGG - Intronic
1053928409 9:43090148-43090170 GAAGCTGCTGACCTTCCTGGTGG - Intergenic
1056138536 9:83652018-83652040 GAAGCTTCTTACATTGCTGGTGG - Intergenic
1057018652 9:91678560-91678582 CTAGTTTCTCACAGTCCTGGGGG - Intronic
1058328223 9:103725262-103725284 CAATCTGCTCACTTTCTTGTTGG - Intergenic
1058918798 9:109593670-109593692 CAAGCTGCTTCCACTCATGGAGG + Intergenic
1060428696 9:123528355-123528377 CAAGCAACTCCCAGTCCTGGAGG - Intronic
1060965358 9:127709467-127709489 CCAGCTGCTCAAACTCCTGGCGG - Exonic
1061664760 9:132154044-132154066 CATGCTGCCCCCATTTCTGGGGG - Intergenic
1203781079 EBV:101146-101168 CAACATCCTCACCTTCCTGGTGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1193846493 X:86478703-86478725 CCTGCTGCTCAAATTCCTAGGGG + Intronic
1194949880 X:100112267-100112289 GAAGCTGCTAACATTCCTTCTGG - Intergenic
1196005646 X:110834344-110834366 GAAGCTGCTTAAATTTCTGGAGG - Intergenic
1197970927 X:132114160-132114182 CAACCTGCTCACAGCCCTGCTGG - Intronic
1198083399 X:133261081-133261103 CAAGATGCTTACAATCTTGGCGG - Intergenic
1200048692 X:153416836-153416858 CAAGCTGCTTCCATTCAGGGTGG + Intergenic
1200136158 X:153875749-153875771 TCAGCTACTCACATTCCTCGGGG + Exonic