ID: 1162321185

View in Genome Browser
Species Human (GRCh38)
Location 19:9971221-9971243
Sequence CCTGGGGGCCCTAGATCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162321175_1162321185 21 Left 1162321175 19:9971177-9971199 CCAGGATTGGGGAGGGGGTCACA 0: 1
1: 1
2: 1
3: 25
4: 286
Right 1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG 0: 1
1: 0
2: 1
3: 23
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162321185 Original CRISPR CCTGGGGGCCCTAGATCTCC GGG Exonic
900157161 1:1207771-1207793 CCTCGGGGCTGAAGATCTCCAGG - Intergenic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
901457252 1:9370241-9370263 CCTGAGGGCCCAAGATCCCTGGG + Intergenic
901627493 1:10632230-10632252 CTTGGTGGCCCCAGCTCTCCAGG - Intergenic
903860530 1:26361788-26361810 CCAGGGGGCACTAGATCTTATGG - Exonic
904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG + Exonic
905732079 1:40304345-40304367 CCTTGGGGCCCTGGAATTCCGGG + Exonic
907447796 1:54520066-54520088 CCTGGGGGTCCTCCATCTCCTGG + Intergenic
908127268 1:61043730-61043752 CCTGAGAGCCCCAGATCTCGCGG - Intronic
910842353 1:91572429-91572451 CCTGGTCGCCCTTGCTCTCCTGG - Intergenic
912398891 1:109372041-109372063 TCTTGGGTCCCTAGCTCTCCTGG - Intronic
912467204 1:109882411-109882433 TCTTGGAGCCCTAGATTTCCAGG + Intergenic
914342758 1:146774385-146774407 CCTGGGGGGCCAAGATTTGCTGG - Intergenic
915949081 1:160175958-160175980 TCTGGAGGTCCTAGACCTCCAGG - Intronic
916238436 1:162614012-162614034 CCTGGGTGCCCTTCATCTGCTGG - Intergenic
916269371 1:162923236-162923258 CCTGTGTGCCCTAGACCTGCAGG - Intergenic
920188647 1:204178469-204178491 CCCAGGGGACCTAGATCTACTGG - Intergenic
921381844 1:214532526-214532548 CCTGGGGTCCCTTCTTCTCCAGG - Intronic
923533798 1:234832501-234832523 CCTGGGAGCCTTAGATCCCTGGG - Intergenic
924823511 1:247517243-247517265 CCTGGGGGCCCTAGAGAACAGGG - Intronic
1069532636 10:69230406-69230428 CCTGGGGACTCTGAATCTCCAGG + Intronic
1069960999 10:72079393-72079415 CCTGGGGGCCCCCGTTCTCCAGG + Intronic
1070321862 10:75360424-75360446 CCTGGGGGCCCTTGTTTTTCAGG + Intergenic
1070759917 10:79017675-79017697 CTGGGGGGCCCTGCATCTCCTGG - Intergenic
1070993361 10:80752628-80752650 CCTGGCTGGCCTTGATCTCCTGG + Intergenic
1072250155 10:93575521-93575543 CCTTGGGGCTCTAGATGGCCAGG + Intronic
1072986991 10:100149574-100149596 CCTGCTGGCCCAAGATCACCAGG + Intergenic
1073328434 10:102656142-102656164 GCTGAGGGCCCTAGCCCTCCCGG + Intronic
1073819762 10:107248183-107248205 CCTGGAGGCCCTTAATCTCAAGG + Intergenic
1076549364 10:131267897-131267919 CCCGGGGGCCCTAGTGCTCAGGG + Intronic
1076615289 10:131750750-131750772 CCTCGGGGCCCCAGACTTCCTGG - Intergenic
1076659864 10:132048337-132048359 CCTGGGAGCCCGAGAGCACCCGG - Intergenic
1077044263 11:537543-537565 CCTGGGCGCCCTCCACCTCCAGG - Exonic
1077053127 11:576616-576638 CCTGGGGGCCCTGCTCCTCCGGG + Intronic
1077755462 11:5024075-5024097 CCTGGGAGCCTTAGATACCCAGG + Intergenic
1077842962 11:5994794-5994816 CCTGGGGTCCCTTCCTCTCCAGG + Intergenic
1080416266 11:32072655-32072677 CCTGGAGGCCCTTGATATCTGGG - Intronic
1081522804 11:43899159-43899181 CCTAGGGGCCCCACCTCTCCAGG + Intronic
1083623494 11:64060250-64060272 CCAGGAGGCCCCAGAGCTCCGGG + Intronic
1083927443 11:65816927-65816949 GCTGGGGTCCCCAGAGCTCCTGG - Intergenic
1084206726 11:67598937-67598959 CCAGGGGGACCTTGAACTCCTGG - Intergenic
1084967849 11:72753652-72753674 CCTGGGGGCCACAGATCACAGGG + Intronic
1087200827 11:95342742-95342764 CCAGGCTGGCCTAGATCTCCTGG + Intergenic
1091597748 12:1890312-1890334 CCTGGGGGCCCAACAGCTTCTGG + Intronic
1092269126 12:7008297-7008319 CAAGTGGGCCCTAAATCTCCTGG + Intronic
1096476821 12:51913638-51913660 CCTGGTGGCCCTGGGTGTCCTGG + Exonic
1096839944 12:54374014-54374036 CCTGGGGGAGCTGGGTCTCCAGG + Exonic
1096865722 12:54561520-54561542 CTTGGGGGCCCTGGGGCTCCTGG + Intronic
1103662099 12:122528499-122528521 CCTGGCTGGCCTTGATCTCCTGG - Intronic
1103701747 12:122851721-122851743 CCTGGGGTCCCTGCACCTCCAGG + Intronic
1104050956 12:125193391-125193413 CCTGGGTGCCTGTGATCTCCAGG + Intronic
1107255142 13:38417124-38417146 CCAGGCTGGCCTAGATCTCCTGG + Intergenic
1107516306 13:41132809-41132831 CCTGGGAGCGGTAGTTCTCCTGG - Intergenic
1107522249 13:41194556-41194578 CCTGGGAGCAGTAGTTCTCCCGG - Exonic
1111581661 13:90230735-90230757 CCTGGGGTCCCTTCTTCTCCAGG - Intergenic
1113423263 13:110186393-110186415 CCTGGAGGCCCTGGATCCCCAGG - Exonic
1113458465 13:110465471-110465493 CCTGGGGGGCCCATTTCTCCTGG - Exonic
1113464270 13:110503189-110503211 CCTGGGGTTCCTGGAGCTCCTGG - Exonic
1113922629 13:113922439-113922461 ATTGAGGGCCCTAGATCTCTGGG - Intergenic
1118124287 14:62882596-62882618 CATGGTGGCCCTATTTCTCCAGG - Intronic
1118381955 14:65224744-65224766 CCTGAGGACCCGACATCTCCTGG + Intergenic
1119425256 14:74530990-74531012 TCTGTGAGCCCTGGATCTCCAGG + Intronic
1120987396 14:90346279-90346301 CCTGGTGGTCCTAGACCTACAGG + Intergenic
1121509098 14:94499206-94499228 CCAGGAGGACTTAGATCTCCAGG + Intronic
1122327354 14:100890646-100890668 CCTGGGGCCCCTGGCTCTCTGGG + Intergenic
1123579499 15:21703585-21703607 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1123616126 15:22146096-22146118 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1124497091 15:30193216-30193238 CCTCGGGGCCCCAGCTCGCCAGG + Intergenic
1124746485 15:32345431-32345453 CCTCGGGGCCCCAGCTCGCCAGG - Intergenic
1126917476 15:53482192-53482214 CCTGGGTGACATACATCTCCTGG - Intergenic
1128190236 15:65686605-65686627 CCTGGTTGGCCTAGAACTCCTGG + Intronic
1130764658 15:86857749-86857771 CCTGGGGGCCAGGGATGTCCTGG - Intronic
1131265627 15:90913577-90913599 CCCGGGTGCCCTTGATCTGCTGG + Intronic
1132391073 15:101438661-101438683 CCTGGGGGACCTGGATCGTCAGG - Intronic
1202988369 15_KI270727v1_random:437830-437852 CCTGGGGGCCTGAGATGTGCAGG + Intergenic
1133192916 16:4147554-4147576 CCTGGGGGGCCTCGCTCTCCTGG - Intergenic
1133200381 16:4200555-4200577 CCTGGGGACTCTGGAGCTCCTGG + Intronic
1133210008 16:4258222-4258244 CCTGGGTGCCCTCGATGTGCTGG + Exonic
1133268647 16:4599924-4599946 CCTGGGCACCCTAAATGTCCTGG - Intronic
1136188210 16:28600609-28600631 CCTGCGAGCCCTTGAGCTCCAGG - Intergenic
1136190682 16:28613603-28613625 CCTGCGAGCCCTTGAGCTCCAGG - Intronic
1136348881 16:29694536-29694558 CCTGGGACCCCTAGATCTTGAGG + Intronic
1136518315 16:30781107-30781129 TCTGGGGGCTCCAGAGCTCCTGG + Exonic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1137978975 16:53054317-53054339 CCTGGTGGCTCTTGAACTCCTGG - Intergenic
1138615842 16:58165629-58165651 CCCTGAGGCCCTAGATCTTCTGG - Exonic
1139991226 16:70940943-70940965 CCTGGGGGGCCAAGATTTGCTGG + Intronic
1140046377 16:71442572-71442594 CCTGGGGGCCCTCTCTCTGCAGG - Intergenic
1141434201 16:83989975-83989997 CCTAGGGCTCCTGGATCTCCAGG - Intronic
1141687670 16:85579553-85579575 CCTGCTGGCCCTGGATCTCCAGG - Intergenic
1141871314 16:86788607-86788629 CCCTGGGCCTCTAGATCTCCAGG - Intergenic
1142191443 16:88720035-88720057 CGTGGGGGCGCTCGGTCTCCAGG - Intronic
1142247994 16:88978536-88978558 CCTGGGGGCCCTGACCCTCCTGG + Intergenic
1142353032 16:89588454-89588476 CCTAGGCTCCCTGGATCTCCGGG - Intronic
1144246616 17:13372533-13372555 CCTGGAGCCCCTGGATATCCTGG + Intergenic
1145078523 17:19875277-19875299 CCTGGTGGCCCTCTGTCTCCTGG - Intergenic
1145871451 17:28276977-28276999 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
1146634823 17:34496182-34496204 CCTGGGGGGTCTTGCTCTCCTGG - Intergenic
1146798947 17:35803568-35803590 CCTGGGAGACCCAGACCTCCAGG + Intronic
1146821286 17:35985140-35985162 CCTGAGGCCCCCAGAGCTCCAGG - Intronic
1147185002 17:38708421-38708443 CCTGGGGGCCCTTACCCTCCTGG - Intronic
1148075509 17:44933224-44933246 CCAGGGAGCCCTGGCTCTCCTGG - Intronic
1149936314 17:60810510-60810532 CCTGGGGTCCCTTCTTCTCCAGG - Intronic
1150641832 17:66954484-66954506 CCTTTGGACCCAAGATCTCCTGG - Intergenic
1150650416 17:67006296-67006318 CCTGGAGGGTCTAGAGCTCCGGG + Intronic
1151412763 17:73942245-73942267 CCTGGGGGCCCAACCCCTCCAGG + Intergenic
1151513299 17:74575678-74575700 CCTGTGGGACCTAGTACTCCTGG - Intergenic
1152236840 17:79143312-79143334 CCTGGGGGACCTGGATATTCTGG + Intronic
1152403488 17:80083238-80083260 CTTGGGGGGCCCAGATCTCAGGG + Intronic
1153840726 18:9005615-9005637 CCTGGAAGCCCCAGGTCTCCTGG - Intergenic
1154101598 18:11479552-11479574 CCTGGGGTCCCTACACCACCAGG - Intergenic
1159481775 18:68998632-68998654 CCAAAGGGCCCTAGAGCTCCTGG + Intronic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1160682186 19:416954-416976 CCTGGGAGCCCTGACTCTCCGGG + Exonic
1160742728 19:694942-694964 CCTGGGGGGCCCAGATCATCGGG - Exonic
1161237644 19:3205745-3205767 ACTGGGGGCCCCACACCTCCAGG - Intronic
1161478271 19:4498188-4498210 CATGGGGGCCCCAGGTCTGCAGG - Intronic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1164589696 19:29499949-29499971 CCTGGGCACCCGAGTTCTCCAGG - Intergenic
1166392431 19:42416625-42416647 CCTGAGGGCCCTAGAATTTCTGG - Intronic
1166543944 19:43623115-43623137 CCTGGGGGACCCAGACCTCTGGG + Exonic
925916212 2:8608270-8608292 CCTGGCAGCCCTGGAGCTCCTGG - Intergenic
926349617 2:11983199-11983221 CCTGGGGGCTCTACACTTCCTGG + Intergenic
927886850 2:26724097-26724119 CCAGGGGGCCCTGGAGCTTCTGG - Intronic
932013257 2:67999302-67999324 CCTGAAGGCCCTAGATTTCCTGG - Intergenic
932213440 2:69950209-69950231 CCTGGGGGCCAGTGATGTCCTGG - Intergenic
932743167 2:74307645-74307667 CCTGGGGTCCCTTCTTCTCCAGG + Intronic
934647202 2:96065830-96065852 CCTGGGGCCCCCAGATCTAGAGG - Intergenic
935663027 2:105486200-105486222 CCTGTGGGCCCAAGAGCTGCAGG + Intergenic
938618178 2:133021253-133021275 CCTGGGGGACCCAGCTCTCTAGG - Intronic
943528501 2:189049381-189049403 CCTGGGGGCCCCACAGGTCCAGG + Exonic
943529175 2:189057381-189057403 CCTGGTGGGCCTGTATCTCCAGG + Exonic
943548686 2:189312172-189312194 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
944855752 2:203765220-203765242 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
946435122 2:219646324-219646346 CCTGGTGGCCCTAGAGCGCAAGG - Intergenic
947144506 2:227052331-227052353 CCTGGGGAACCTGGACCTCCTGG - Exonic
947144996 2:227056070-227056092 CCGGGAGGCCCCACATCTCCCGG + Exonic
947147049 2:227077929-227077951 CCTGGGTGGCCTGGAACTCCTGG + Exonic
947147054 2:227077947-227077969 CCTGGGTGGCCTCGCTCTCCTGG + Exonic
947147079 2:227078016-227078038 CCTGGGGGGCCCAGAGGTCCAGG + Exonic
947149438 2:227099661-227099683 CCTGGGTGCCCTCGATTTCCAGG + Exonic
947166380 2:227266461-227266483 CCTGGAGACCCTAGATAGCCTGG - Exonic
947167385 2:227276429-227276451 CCAGGGGGCCCTGGAGGTCCTGG - Exonic
947167868 2:227280916-227280938 CCTGGGGGTCCTTGTTCTCCAGG - Exonic
947168046 2:227282511-227282533 CCTGGTGGCCCTAAAATTCCCGG - Exonic
947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG + Intronic
1170773533 20:19355504-19355526 CCTGGGGGTCCTACAGCTCCAGG - Intronic
1172606326 20:36216710-36216732 CATGTGGGCCCTAGAGCCCCGGG - Intronic
1174349560 20:49957087-49957109 CCTGGGGTCCCTTCTTCTCCAGG - Intergenic
1175899752 20:62355310-62355332 CCTTGGGGCCCTAGGCTTCCAGG - Intronic
1176002821 20:62840607-62840629 CCTGGAAGCCCAGGATCTCCGGG - Exonic
1176125584 20:63473164-63473186 CCTGGTGGCCCCAGCGCTCCTGG + Intergenic
1177387405 21:20425874-20425896 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
1177540947 21:22493491-22493513 CCTTGGGTGCCTAGATCACCAGG + Intergenic
1177779551 21:25607700-25607722 CCTGGGGGCCCTGCACCTCTGGG - Intergenic
1180083288 21:45496515-45496537 CCTGGGGGCCCTGGAGGTCCTGG - Exonic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1181719397 22:24762408-24762430 CCTGGGGGACCCAGAGCACCTGG - Exonic
1182085693 22:27559879-27559901 CCTGGGGACCCTAGATCCGGTGG - Intergenic
1182816178 22:33166194-33166216 CCAGGTGGCCCTAGGTATCCTGG - Intronic
1183270360 22:36858480-36858502 CCTGGGGGACAAAGATGTCCAGG - Intergenic
1184448323 22:44567304-44567326 CCTGGGGTCCCTTCTTCTCCAGG - Intergenic
1184549563 22:45197208-45197230 CCTGCCGGCCCTAGACATCCTGG - Exonic
950403357 3:12788306-12788328 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
950543596 3:13626362-13626384 CCTGGTGGCCCAAGGTCTGCTGG + Intronic
950610969 3:14126205-14126227 CCTGTGGGCCCGAAATGTCCTGG - Intronic
951657428 3:25025420-25025442 CCTGGGGGACCTACATTTCTGGG + Intergenic
953333387 3:42073139-42073161 CCTGGGGCCCCTAGCTGTTCTGG + Intronic
954132231 3:48566676-48566698 CCTGGGGTCCCTGGAGCTCCTGG - Exonic
954812766 3:53258045-53258067 CCTGAGGTCCCTGGAGCTCCAGG - Intergenic
958169351 3:89918403-89918425 CCTGGGAGGCCTAGCTCTCCAGG + Intergenic
959278173 3:104304332-104304354 CCTGGGGTGCCTACACCTCCAGG + Intergenic
959451985 3:106516434-106516456 CCTGGGAGCCTTAGATATTCCGG + Intergenic
959672184 3:108991102-108991124 CCTCAAGGCCCTAGATGTCCTGG - Intronic
960142152 3:114161132-114161154 CTTGGGGACCCTAGTTCTCGGGG + Intronic
960933441 3:122878429-122878451 CCTAGGGTCCCTGGAGCTCCAGG + Intronic
961666432 3:128495928-128495950 CCTGAGGGCCCCACATCTCCAGG - Intergenic
961751095 3:129095364-129095386 CCTGGGGACCCTAGAGGGCCAGG - Intronic
961920366 3:130418884-130418906 CCCACTGGCCCTAGATCTCCAGG - Exonic
962251153 3:133836838-133836860 ACTGGGGGCCCCAAAGCTCCAGG - Intronic
962779152 3:138694847-138694869 CCGGGAGGCCCTAGAGCTTCTGG - Exonic
964483395 3:157163570-157163592 CCTGGGGTCCCTGCTTCTCCAGG + Intergenic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
964887303 3:161499212-161499234 CCTTGGGGCCCAACAACTCCTGG - Exonic
965544732 3:169903890-169903912 CCTGGGGCCCGTTGTTCTCCAGG + Intergenic
966234533 3:177686233-177686255 CCTGGTGGCCCCTGATCTGCTGG - Intergenic
967977638 3:195044399-195044421 CATGGGGGACCTAGCCCTCCAGG - Intergenic
968914955 4:3493345-3493367 CCTGGGGGGCCTCCATCACCAGG - Exonic
969257888 4:6015004-6015026 CCTGGGGTCCATTGATCTTCTGG + Intergenic
969442559 4:7226098-7226120 CCTGGGGGCCTCTGATCTCCAGG + Intronic
970373798 4:15435861-15435883 CCAGGGGGCCCTGGAGGTCCAGG - Exonic
970439856 4:16071346-16071368 GCTGGAGGACCTTGATCTCCAGG - Intronic
970628085 4:17912042-17912064 CCTGGGGTCCCTTCTTCTCCAGG - Intronic
979050228 4:115921033-115921055 CCTGCGGTCCCTTGTTCTCCAGG - Intergenic
980469616 4:133234245-133234267 CCTGAGGGCCCAAGATCAGCTGG - Intergenic
982779056 4:159471521-159471543 CATGGGTCCACTAGATCTCCTGG + Intergenic
985394904 4:189531613-189531635 CCTGGGTGCCCTAGCTTTGCAGG - Intergenic
985737635 5:1594099-1594121 CCTGGGGTCCAGAGACCTCCCGG - Intergenic
985827698 5:2205056-2205078 CCTTGGGGCCCAAGACCTCCAGG - Intergenic
986147301 5:5090580-5090602 GCTGAAGGCCCTAGAGCTCCAGG + Intergenic
986406131 5:7426752-7426774 GCTGGCAGCTCTAGATCTCCTGG - Intronic
989012190 5:36885547-36885569 CCTGGGGTCCCTTCTTCTCCAGG - Intronic
991135437 5:63176706-63176728 CCTGGGAGCCTTAGATGACCAGG - Intergenic
992915433 5:81446894-81446916 CCTGGTGGCCCTCCACCTCCTGG + Exonic
993170358 5:84411729-84411751 CCAGGGGGGCCTGGAACTCCTGG + Intergenic
993311369 5:86337586-86337608 CCTGTGGGCTCTACATCACCTGG - Intergenic
995739127 5:115336024-115336046 CCTGGAGGCCTGACATCTCCAGG - Intergenic
1000351278 5:160354848-160354870 CCTGAGGGCCCTGGGGCTCCTGG + Exonic
1001250243 5:170141578-170141600 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
1002311063 5:178314072-178314094 CCTGGGGACCCTACTGCTCCTGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002547593 5:179960554-179960576 ACAGGGGGCCCTAGACCACCTGG + Intronic
1003297442 6:4844339-4844361 TGTGGGGGCCCTAGAGCTCCCGG + Intronic
1006295781 6:33169426-33169448 CCTGGTGGCCCTGGCTCTCCTGG + Exonic
1006687804 6:35852022-35852044 CCAGGGTGCCCTAGATCGCTGGG - Intronic
1007407908 6:41645298-41645320 CCTAGGGGCCCTAGTCCTGCAGG + Intronic
1007658726 6:43469155-43469177 CCTGTGGGCCCTAGACTTCACGG + Intergenic
1007789026 6:44298294-44298316 GGTTGGGGCCCCAGATCTCCTGG + Intronic
1008604877 6:53130729-53130751 GCTGGGGGCGGTAGATTTCCTGG - Intronic
1009924368 6:70102193-70102215 CCTGGGGGTCCTGGTTTTCCGGG - Exonic
1009927863 6:70142029-70142051 CCAGGGGGTCCGGGATCTCCAGG - Exonic
1009935225 6:70225931-70225953 CCTGGGAGACCTATAGCTCCAGG + Exonic
1011691276 6:89871652-89871674 CCAGGGTGGCCTTGATCTCCTGG - Intronic
1013099287 6:106974210-106974232 CCAGGGAGCCCGAGCTCTCCAGG + Intronic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1016297030 6:142584389-142584411 CCTGGAGGCCCAAGTTTTCCTGG + Intergenic
1017536282 6:155350381-155350403 CCTGGGAGCCTTAGATACCCAGG - Intergenic
1019388347 7:771217-771239 CCTGGAGGCCCTAGACCCTCGGG - Intronic
1019573797 7:1726527-1726549 CCCGGGGTCCCTGGATCCCCTGG + Intronic
1019645987 7:2129174-2129196 CCTGGTGGCCCCAGCTCCCCCGG - Intronic
1022086753 7:27075886-27075908 CCAGGGTGGCCTTGATCTCCTGG - Intergenic
1022574692 7:31486277-31486299 CCTGGGGGCCCTAAATATGCTGG + Intergenic
1025035969 7:55592663-55592685 CCTGGGGGGCCAGGGTCTCCAGG - Intergenic
1027144064 7:75681714-75681736 CCTGGGTGGCCTTGAACTCCTGG + Intronic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1037803821 8:22048911-22048933 CCTGGGGGCCCCAGCGCTGCGGG - Intergenic
1037912368 8:22751299-22751321 CTTGGGAGCCCTAGAGCTCACGG - Intronic
1039394698 8:37215331-37215353 CCTGGGGGCCGCACATCTTCAGG - Intergenic
1044960967 8:97530179-97530201 CCTCGGGTGCCTACATCTCCAGG + Intergenic
1045727747 8:105195567-105195589 CCTGGGTTTCCCAGATCTCCTGG + Intronic
1045734859 8:105283101-105283123 CCCAGGGGCCCTAGGTCCCCAGG + Intronic
1046981906 8:120345488-120345510 CCTGGGGGTCCTTGTTCACCAGG - Exonic
1046984176 8:120369359-120369381 CCTGGGCCCCCTGGCTCTCCTGG + Exonic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1048854700 8:138676598-138676620 CCTGGGATCCCTGGTTCTCCTGG - Exonic
1049638890 8:143705488-143705510 CCTGGGGGTCCTCAAGCTCCTGG + Intronic
1049659511 8:143813495-143813517 CCTGGTGACCCTGGAGCTCCGGG - Exonic
1049818346 8:144618962-144618984 CCTGGGGGCCCCACGTCTGCAGG - Intergenic
1049998297 9:1051393-1051415 CCTGGGGGCCCTGGAGATACAGG + Intronic
1052094791 9:24370425-24370447 CCCAGGGGCCTTAGATATCCAGG - Intergenic
1052613023 9:30800386-30800408 CCTGGGGTCCCTTCTTCTCCAGG + Intergenic
1057547739 9:96030797-96030819 CCTGTGGGCCCCAGTTGTCCTGG - Intergenic
1057606023 9:96498330-96498352 CTTGGGGACCCTTGATCTGCTGG - Intronic
1057800003 9:98185199-98185221 CCTGGAGGCCCCACAGCTCCTGG + Intronic
1059449624 9:114362338-114362360 CCTGGGGTCCCTCAGTCTCCAGG - Intronic
1060728778 9:126023872-126023894 CTTGGGGGCCCTCCATCTCGGGG + Intergenic
1062117141 9:134815591-134815613 CCGGGGGGGCCAGGATCTCCAGG - Exonic
1062182400 9:135197580-135197602 GCTGGCAGCCCTAGATCGCCGGG - Intergenic
1062358722 9:136177519-136177541 CCTGGAGGCGATAAATCTCCAGG - Intergenic
1062361378 9:136189990-136190012 TCTCAGGGCCCTAGATCCCCAGG + Intergenic
1062590232 9:137271255-137271277 CCTCGGGGGCCTGGGTCTCCTGG + Intronic
1203585797 Un_KI270747v1:2330-2352 CCTGGGGCTCCTAGGGCTCCTGG - Intergenic
1189928616 X:45983706-45983728 CCTGGGGTCCCTTCTTCTCCAGG - Intergenic
1190057036 X:47187044-47187066 CCTGGTGGTGCTAGATTTCCTGG - Intergenic
1191739172 X:64418418-64418440 CCTGGGAGCCTTAGATACCCAGG - Intergenic
1192832830 X:74768025-74768047 CCTGGGAGCTTTAGATATCCGGG - Intronic
1200000209 X:153056301-153056323 CCTGGGGGCCCCAGGTCCCCGGG - Intergenic
1200123961 X:153804561-153804583 CCAGGTGGCACTTGATCTCCAGG + Exonic
1202337876 Y:23829597-23829619 CCTGTGGGCCCAAGTTCTGCCGG + Intergenic
1202532890 Y:25840474-25840496 CCTGTGGGCCCAAGTTCTGCCGG - Intergenic