ID: 1162322615

View in Genome Browser
Species Human (GRCh38)
Location 19:9978942-9978964
Sequence CAGGACCCCTTGGGAAAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162322615_1162322630 14 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322630 19:9978979-9979001 CCCTACAGGAGTGCAAAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 168
1162322615_1162322633 30 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322633 19:9978995-9979017 AGGAGGGAAGTCAAGCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 265
1162322615_1162322628 13 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322628 19:9978978-9979000 CCCCTACAGGAGTGCAAAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 171
1162322615_1162322632 29 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322632 19:9978994-9979016 AAGGAGGGAAGTCAAGCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 234
1162322615_1162322625 10 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322625 19:9978975-9978997 TTCCCCCTACAGGAGTGCAAAGG 0: 1
1: 0
2: 1
3: 75
4: 3212
1162322615_1162322622 0 Left 1162322615 19:9978942-9978964 CCCTTCTTTCCCAAGGGGTCCTG 0: 1
1: 0
2: 4
3: 38
4: 305
Right 1162322622 19:9978965-9978987 GTGGTCCCAGTTCCCCCTACAGG 0: 1
1: 0
2: 0
3: 16
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162322615 Original CRISPR CAGGACCCCTTGGGAAAGAA GGG (reversed) Exonic
900013504 1:134594-134616 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
900043572 1:490577-490599 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
900065010 1:725580-725602 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
900866581 1:5273271-5273293 CAGAACTGATTGGGAAAGAAAGG + Intergenic
901216058 1:7556017-7556039 CAGGACCACTTGGGGAAGCAGGG + Intronic
901413674 1:9102707-9102729 CAGGAGCCATCGGCAAAGAATGG - Exonic
902460926 1:16576114-16576136 CAGGACTTCCTGGGTAAGAACGG - Intronic
902532196 1:17097722-17097744 AAGGACCCCAGGGGAAAGAAGGG + Intronic
903630019 1:24761334-24761356 CAGGGCAACTTGAGAAAGAATGG + Intronic
903770500 1:25760777-25760799 CAAGACCCCTTGGGAGAGAAAGG - Intronic
904052826 1:27650490-27650512 CAGAAGCCCTAGGGAAATAAAGG + Intergenic
904294875 1:29513659-29513681 CAGGACCCCTTAGGACCGAGAGG + Intergenic
904827230 1:33281440-33281462 CAGGACCACCTGGGAAAGACAGG - Intronic
905916503 1:41688294-41688316 CAGGACACCCTGAGAAAGACAGG - Intronic
905985737 1:42279885-42279907 CAGGAGCCATTTGGAATGAAGGG - Intronic
906396996 1:45474991-45475013 AAGGACCACTTGGGGCAGAAAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907772270 1:57477439-57477461 CATGACCCCTTAGTAAAGAAAGG + Intronic
909076165 1:71053201-71053223 CAGGACCCCTCGGGAATGAGGGG + Intergenic
912148154 1:106820189-106820211 CAGCAGCCCTGGGGAAAAAAGGG - Intergenic
913604494 1:120452462-120452484 CAGGACTTCTTGGGTAAGAACGG + Intergenic
914084047 1:144436742-144436764 CAGGACTTCTTGGGTAAGAACGG - Intronic
914190068 1:145402014-145402036 CAGGACTTCTTGGGTAAGAACGG - Intronic
914277116 1:146135154-146135176 CAGGACTTCTTGGGTAAGAACGG - Intronic
914364929 1:146969727-146969749 CAGGACTTCCTGGGTAAGAACGG + Intronic
914365690 1:146976022-146976044 CAGGACTTCCTGGGTAAGAACGG + Intronic
914395683 1:147265469-147265491 CAAGACATCTGGGGAAAGAAGGG + Intronic
914486753 1:148117419-148117441 CAGGACTTCCTGGGTAAGAACGG - Intronic
914538161 1:148586102-148586124 CAGGACTTCTTGGGTAAGAACGG - Intronic
914587082 1:149072565-149072587 AAGGACTTCTTGGGTAAGAACGG - Intronic
916531535 1:165661037-165661059 CAGGACCCCTTCTGAAATGAAGG + Intronic
916650273 1:166828730-166828752 CAGGTCCCCTTGGCCAAGAGGGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
919415097 1:197298063-197298085 CAGGAGCCATAGGGAAATAAAGG + Intronic
919588198 1:199465339-199465361 CAGGACCCCTTCTGAAATAGGGG + Intergenic
920460952 1:206139946-206139968 CAGGACCCCTAGTGAAGGAGAGG + Intergenic
920562389 1:206948064-206948086 CTGGACCCCAGGGGAGAGAAGGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
920760937 1:208783173-208783195 TAAGACCCCTTGGGAGAGCAAGG + Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922099911 1:222471595-222471617 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
922261943 1:223951087-223951109 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
922688092 1:227663753-227663775 CAGACTCCTTTGGGAAAGAATGG + Intronic
922700784 1:227759099-227759121 GTGAACCCTTTGGGAAAGAAGGG + Exonic
1063221007 10:3967826-3967848 TAAAGCCCCTTGGGAAAGAATGG - Intergenic
1063391519 10:5652776-5652798 CAGGAGAACTTGGGAAAGAGGGG - Intronic
1066733375 10:38452310-38452332 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1067088840 10:43256425-43256447 CAGGAACCTCAGGGAAAGAAAGG + Intronic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1067386258 10:45819798-45819820 CAGGAACACTTGGGAAGGCAGGG + Intergenic
1068117800 10:52753027-52753049 CAGCACCCCATGGAAGAGAAAGG - Intergenic
1068550715 10:58404844-58404866 CATGTATCCTTGGGAAAGAAAGG - Intergenic
1071676542 10:87660322-87660344 GAAGAGCTCTTGGGAAAGAAAGG - Intronic
1072554356 10:96503559-96503581 CAAGCCTCCTTGGGAAAGATTGG + Intronic
1073467734 10:103704191-103704213 CAGAACCACCTGGGACAGAATGG + Intronic
1074487682 10:113902751-113902773 CATAACCTCTTGGCAAAGAAAGG - Intronic
1074516686 10:114176760-114176782 CAAGACCCTTTCAGAAAGAAAGG + Intergenic
1074694993 10:116042264-116042286 CAGGACCAAGTGGGGAAGAAAGG - Intergenic
1075435189 10:122434110-122434132 CAAGACCCAATGGGAAAGAAAGG - Exonic
1076969844 11:126808-126830 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1077590300 11:3485846-3485868 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1077942929 11:6862988-6863010 CAGGTCCCCTGAGGAAAGGAAGG + Intergenic
1081800913 11:45858768-45858790 CTGAACCCTTTGGGAAAGAACGG + Exonic
1082671506 11:56041641-56041663 GAGGTCCCCTTGGGGAAGGATGG - Intergenic
1083259989 11:61517691-61517713 CGGGACCCCCTGAGAAGGAAGGG + Intronic
1083271666 11:61575989-61576011 AAGGACCCCTTGGGATAGAATGG - Intronic
1084246019 11:67857627-67857649 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1084269166 11:68019943-68019965 CAGGACCCCTTAGGAAGGGATGG + Intronic
1084826656 11:71736873-71736895 GGGGACCATTTGGGAAAGAAGGG + Intergenic
1084907621 11:72360340-72360362 CAAGACCACTTGAAAAAGAATGG - Intronic
1086450340 11:86909319-86909341 CAGGAACCCATGGGAGAGACAGG - Intronic
1088286748 11:108198048-108198070 CAGACCCCCTTGGCAAACAATGG + Intronic
1088436322 11:109817058-109817080 CAGGACTTCCTGGGAAGGAAAGG + Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1089564477 11:119363711-119363733 CAGGAGACCCTGGGAAAGGAGGG + Intronic
1089653452 11:119930335-119930357 TAGGTCCCTTTGGGAAAGGATGG + Intergenic
1090226595 11:125075687-125075709 CACTACCACTTGGGAAACAAAGG - Intronic
1091350845 11:134892784-134892806 AAGGACCCGGTGGGAAATAATGG + Intergenic
1093030358 12:14282977-14282999 CAGTTCCCTTTGGGAAAAAAGGG - Intergenic
1094045294 12:26159913-26159935 CAGGATCCCTTGTTAGAGAAGGG + Intronic
1095899530 12:47313674-47313696 CTGAAGACCTTGGGAAAGAATGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097445229 12:59662540-59662562 CAGGAGCCCTGGGGAGAGAATGG - Intronic
1097821588 12:64133589-64133611 GAGGTCCCCTTGGGGAAGGATGG + Intronic
1098122509 12:67256789-67256811 CAGGGCCCCTTGGGAACGCATGG - Intergenic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099859589 12:88210036-88210058 AAGGTCTCCTTGGGGAAGAATGG + Intergenic
1100408756 12:94294194-94294216 CAGGACCCTGTGGGACAGATGGG - Intronic
1102163513 12:110787964-110787986 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1102926402 12:116829436-116829458 GAGGGCCCTTTGGGAAACAATGG + Intronic
1103060489 12:117854665-117854687 GCGGATCCCTTGGGACAGAAAGG + Intronic
1104042298 12:125138637-125138659 CAGGACAACCAGGGAAAGAAAGG - Intronic
1105930218 13:25045519-25045541 CAGAAACCCTGGGGAAAAAAAGG + Intergenic
1106017857 13:25885890-25885912 CAGGATCCCTAGTGAAGGAAGGG + Intronic
1106135637 13:26971467-26971489 CATGACCCTTGGGGAAAGAAGGG - Intergenic
1111440896 13:88281715-88281737 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
1112333952 13:98498801-98498823 CAGGAGCCAGTGGGACAGAAAGG + Intronic
1112700135 13:101998422-101998444 CAGAACTCTTTGGGAGAGAATGG + Intronic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1115095488 14:29630768-29630790 GAGGAGCCCTTGGGAATGACGGG + Exonic
1116763006 14:49038209-49038231 CTGGATCCCTAGGGAAAGACTGG + Intergenic
1117638213 14:57769699-57769721 CAGGGCCCCTATGGAAAGTATGG + Intronic
1119372107 14:74155404-74155426 CATGGCCCCTTGGGAAATCAGGG + Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121577412 14:94999452-94999474 CAGGAGCCCTTTGGAAATGAAGG - Intergenic
1124010012 15:25830572-25830594 CAGGACCCCCCCGGAGAGAAAGG - Intronic
1124378002 15:29140823-29140845 CAGAGCCACCTGGGAAAGAAGGG - Intronic
1124391047 15:29257886-29257908 CAGCATCCCTTGGGAAAGTTAGG + Intronic
1125884538 15:43218841-43218863 CAAGACCCAGTGGGAGAGAAGGG - Intronic
1126861093 15:52883932-52883954 CAGGACCCCTTAAGAAGGGATGG + Intergenic
1128209131 15:65880920-65880942 CAGTAACCCTTAGCAAAGAATGG + Intronic
1128317705 15:66671432-66671454 CAGGCTCCCTTGTGAAAGGAAGG - Intronic
1128543053 15:68550358-68550380 CAGGACCCCTTCTGAAAGCCAGG + Intergenic
1128558802 15:68651043-68651065 CAGGACCCATAGTGAAGGAATGG + Intronic
1128675632 15:69606569-69606591 GAGCACCCCCTGGGGAAGAAGGG + Intergenic
1130702719 15:86201728-86201750 CAGGACCCCTTGGGAATCTAGGG + Intronic
1130899397 15:88195757-88195779 CAAGACCCCTTGGGGAGTAAGGG - Intronic
1131396596 15:92091366-92091388 CAGGATCCCTGTGGAAGGAAGGG - Intronic
1132102737 15:99036621-99036643 CAGGAATCCTGGGGAAAGAGAGG + Intergenic
1133229802 16:4361107-4361129 CAGGAGCCCTTGGGAGACACTGG + Intronic
1133355668 16:5134920-5134942 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1134062184 16:11205956-11205978 CAGCATCCCCTGGGAAGGAAGGG - Intergenic
1134279159 16:12802764-12802786 CAAGACCCTCAGGGAAAGAACGG + Intronic
1134647783 16:15884178-15884200 AAGGACACCTTGGAAAAAAAGGG - Exonic
1135083079 16:19452784-19452806 CAGGACCCCTTCTGAAATGAGGG + Intronic
1135546067 16:23367668-23367690 CAGGCTCCCTTGGGAAAGCAGGG - Intronic
1137060884 16:35791013-35791035 CAGGAGCCCCTGGGAGACAAAGG - Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1139274832 16:65717821-65717843 CAGAAGCACTTGGGAAAAAAAGG + Intergenic
1140925624 16:79580525-79580547 CAGTACCTCGGGGGAAAGAATGG + Intergenic
1142245578 16:88968706-88968728 CAGGCCCCCTTGGGAATAAGCGG + Intronic
1142450835 16:90172324-90172346 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1142456730 17:61367-61389 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1143013335 17:3878437-3878459 CAGGACTTCAGGGGAAAGAAGGG + Intronic
1144256293 17:13471527-13471549 CAGGACCCTGGGGTAAAGAAAGG + Intergenic
1144362124 17:14505544-14505566 CAAGACCCCTTAAGAAAGAAGGG - Intergenic
1146284900 17:31567805-31567827 CAGGACCCCTTTGGGATGAGGGG + Intergenic
1147968438 17:44206814-44206836 CAGGCCCCTCTGGGAAGGAATGG + Exonic
1149038532 17:52159643-52159665 CAGGGCCCCAGGGGAAAGTAGGG + Intronic
1149847955 17:60018313-60018335 CCGGACCCCTTTGAACAGAAGGG + Intergenic
1150086309 17:62274930-62274952 CCGGACCCCTTTGAACAGAAGGG + Intronic
1152125017 17:78441397-78441419 CGGGGCCCCTCGGGAAAGAAAGG - Intronic
1152790895 17:82278964-82278986 CAGGGCCCCATGGGAAAGGCAGG - Intergenic
1154068271 18:11129676-11129698 GAGGTCTCCTTGGGGAAGAATGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156192245 18:34733127-34733149 GAGGTCTCCTTGGGGAAGAATGG + Intronic
1157294899 18:46435406-46435428 CAGGGCCCCTGGGGGAGGAAGGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1157573501 18:48729199-48729221 CTGGACCCCCTGGGTAAGAGGGG - Intronic
1159654972 18:71022481-71022503 CTGGAGGCCCTGGGAAAGAAAGG + Intergenic
1160630665 18:80245108-80245130 CAGCTCCACTTGGCAAAGAAGGG - Intronic
1160646647 19:196726-196748 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1163818746 19:19484006-19484028 CACCACCCCTTGGGAAAGGAGGG + Intronic
1164194398 19:22943075-22943097 CAGTACACCTTGAGAGAGAAAGG - Intergenic
1164750844 19:30653752-30653774 CGGGACCCCTTGGCGGAGAAGGG - Intronic
1167333252 19:48869078-48869100 CAGGTCCCCTAGGGAGAAAAGGG + Intergenic
925615781 2:5743485-5743507 CAGGACCTCTTGGTGAAGATAGG + Intergenic
927169651 2:20358101-20358123 CACCACCCCTGGGGAAATAAAGG - Intergenic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
928420141 2:31132010-31132032 CAGGTCACTTTGGGAAACAAAGG + Intronic
929202048 2:39245650-39245672 CTCGATGCCTTGGGAAAGAAGGG - Intergenic
931424079 2:62154913-62154935 CTGGAGCCTTTGGGAAAGCATGG - Intergenic
931668293 2:64625548-64625570 CAGGACCCTTTGGGATGGAGGGG - Intergenic
931828964 2:66030736-66030758 CATGACCCCTTTGGGAAAAATGG + Intergenic
934607284 2:95706181-95706203 CAGAAACCCATAGGAAAGAAAGG - Intergenic
935400330 2:102653679-102653701 CAGCACCCCATGTGAAAGCATGG + Intronic
937846310 2:126583151-126583173 CATGACCCCATTGGATAGAAAGG + Intergenic
940606109 2:155925775-155925797 GGGGTCCCCTTGGGAAAGGATGG + Intergenic
940839164 2:158559344-158559366 CTGGGTCCCTTTGGAAAGAAAGG - Intronic
941427755 2:165369598-165369620 CCAGAGCCCTTGGGAAAGAGTGG - Intronic
942395753 2:175547691-175547713 CAGCACCCCTTGTCAAAGACTGG - Intergenic
942642655 2:178075810-178075832 GAGGTCCCCTTAGGAAATAATGG + Intronic
944248797 2:197560509-197560531 TAGGAATCCCTGGGAAAGAATGG - Intergenic
944802811 2:203253169-203253191 CAGGACCCGTGGGGACAGAAGGG - Intronic
945947325 2:216006853-216006875 CAGGTGCCAGTGGGAAAGAAGGG - Intronic
946394421 2:219435948-219435970 CAGGGCCCCATGGGCATGAATGG + Intronic
947475870 2:230447247-230447269 GGAGACCCCTGGGGAAAGAAAGG + Intronic
947539766 2:230968345-230968367 CAGGAACCCTGAGGACAGAATGG + Intergenic
947670189 2:231930833-231930855 CAGGACCCCTGGGAAAGGGAAGG - Intergenic
948427122 2:237895258-237895280 CAGGACCCCTTTGCACAGCAGGG - Intronic
948620274 2:239230223-239230245 TGGGACCCCTTGGTCAAGAAGGG + Intronic
1169745028 20:8934965-8934987 AAGGGCCCCTTGGGAAAGGCTGG + Intronic
1171317751 20:24210372-24210394 GAGAACCTCTTTGGAAAGAATGG - Intergenic
1173709326 20:45140662-45140684 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
1175908685 20:62394372-62394394 CACAGCCCCTCGGGAAAGAAAGG + Intronic
1176278859 20:64289496-64289518 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1176997962 21:15578806-15578828 GAGGACCCTTTGGGGAAGAATGG - Intergenic
1179012482 21:37566462-37566484 CAGGCCCTCTGGGGGAAGAAGGG + Intergenic
1179090128 21:38257089-38257111 CAGGTTGCCTTGGGAAAGATAGG - Exonic
1181045246 22:20211229-20211251 CCCAACCCCTTGGGAAAGGAAGG - Intergenic
1183398436 22:37586829-37586851 CAGGACCCCTTCTGAAATGAGGG - Intergenic
1183724087 22:39578808-39578830 CTGGACCCCAAGGGAAAGAACGG - Intronic
1184546600 22:45173822-45173844 CAGGAGCCCTTGGGCAACTAAGG + Intronic
1185285367 22:49997535-49997557 CAGGCCCACTGGGGAAGGAAGGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950442895 3:13020104-13020126 CTGGAAACCTTGGGACAGAAGGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951735569 3:25859375-25859397 CAGGACTCCATGAGAAAGAAAGG - Intronic
953145595 3:40271605-40271627 CAGCTTCCCTTGGGAAGGAAAGG - Intergenic
955260913 3:57389692-57389714 CAAGACCCATTGGCAAGGAATGG + Intronic
955835538 3:63050521-63050543 CAGTTCCCCTGTGGAAAGAAAGG - Intergenic
955864368 3:63367169-63367191 CAGGCCCACTGGGGAAAGTAAGG + Intronic
956272438 3:67462293-67462315 CAGGACCCCTTCGGAAATGAGGG - Intronic
956782238 3:72613121-72613143 CAGCACCTCTGGGGAAAAAAAGG - Intergenic
957060349 3:75476352-75476374 GGGGACCATTTGGGAAAGAAGGG - Intergenic
958892128 3:99794748-99794770 CAGGGCCCCCTGGGAAAGCCAGG + Exonic
959776440 3:110169935-110169957 CAGGATCCCTTGAAAAATAAAGG - Intergenic
959944310 3:112111315-112111337 CAGCACCCTTTGGGAAGCAATGG - Intronic
961293043 3:125863058-125863080 GGGGACCATTTGGGAAAGAAGGG + Intergenic
961344873 3:126257496-126257518 AAGGCCCCATTGGGAGAGAAGGG - Intergenic
961911397 3:130320543-130320565 CAGGACATTTGGGGAAAGAAAGG - Intergenic
962347063 3:134626079-134626101 CAGGGACCCTTGGTTAAGAAAGG - Intronic
962506627 3:136052833-136052855 CAGAAGGGCTTGGGAAAGAATGG - Intronic
963453531 3:145515675-145515697 GAGGTCTCCTTGGGAAAGGATGG - Intergenic
964519881 3:157553622-157553644 CAGGACCCCTTCTGAAATGAGGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966874828 3:184315746-184315768 CAGCACCTGTTGGGAAAGAGTGG - Exonic
968298418 3:197594856-197594878 CAGGACCCGAGGGGAAAGAAGGG + Intergenic
968371034 3:198222796-198222818 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
969004236 4:4006428-4006450 GGGGACCATTTGGGAAAGAAGGG - Intergenic
969552152 4:7877268-7877290 CAGGACCCGTTGTGAGAAAATGG - Intronic
969809668 4:9638286-9638308 GGGGACCATTTGGGAAAGAAGGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973102752 4:46293351-46293373 AAGGTCTCCTTGGGGAAGAATGG - Intronic
975736468 4:77386024-77386046 CAGGACCCCTTGTGGAATGAGGG - Intronic
976034376 4:80797183-80797205 AAGGTCCCCTTGGGGAAGGATGG + Intronic
976054540 4:81048062-81048084 CAAAAATCCTTGGGAAAGAAGGG - Intronic
977465797 4:97381968-97381990 TAGGTCTCCTTGGGGAAGAATGG - Intronic
978604768 4:110467360-110467382 TAGGAACCCTTTGGAGAGAAAGG + Intronic
979259720 4:118635280-118635302 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
979328657 4:119405341-119405363 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
979932089 4:126643383-126643405 CAGCTCCCCTTGGGAAGGACTGG - Intergenic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
980596297 4:134959648-134959670 CAGGATCTCTTGGGTAATAAAGG + Intergenic
980827747 4:138092363-138092385 GAGGTCCCGTTGGGCAAGAAGGG + Intergenic
981834795 4:149042517-149042539 GAGGTCTCCTTGGGGAAGAATGG - Intergenic
983098131 4:163590179-163590201 CAGGAAACCTTGGCAAAGGATGG - Intronic
984326027 4:178252014-178252036 CAGGACACTTTGAGAATGAAAGG - Intergenic
985629275 5:1006320-1006342 CCGGACCCTCTGGGAAGGAATGG + Intergenic
985975567 5:3416879-3416901 CAGGAACCCTTGGAACAGAGAGG - Intergenic
988161010 5:27518298-27518320 GAGGCCTCCTTGGGGAAGAATGG + Intergenic
988267689 5:28972779-28972801 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
988732706 5:33989209-33989231 AAGGATCCCTTTTGAAAGAAGGG + Exonic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
993412768 5:87593234-87593256 GAGGTCTCCTTGGGGAAGAATGG + Intergenic
993735318 5:91469388-91469410 CAGGACCCTTTCTGAAAGAACGG - Intergenic
994647882 5:102492218-102492240 CAGGACTCTATTGGAAAGAATGG + Intronic
997226173 5:132210965-132210987 CAGGAACTCTGAGGAAAGAATGG + Intronic
998056764 5:139085263-139085285 CAGGACCACAGTGGAAAGAAAGG + Intronic
999115875 5:149162960-149162982 CAGGATGCATTGGAAAAGAAAGG + Intronic
999282391 5:150374253-150374275 CAGCACCCCCTGGGAAGGCAGGG + Exonic
999916788 5:156271311-156271333 CAGGACCCCTCCAGATAGAAAGG - Intronic
1000535183 5:162470485-162470507 CAGCACCCATTGAGAAACAATGG + Intergenic
1001477289 5:172059676-172059698 AAGGAACTCTTGGGCAAGAAGGG - Intronic
1001827853 5:174760508-174760530 CAGCAGCCCCAGGGAAAGAAAGG + Intergenic
1002730271 5:181328352-181328374 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1002754259 6:145752-145774 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1003139903 6:3462563-3462585 CAGGACCCCTTGGAGACAAATGG + Intergenic
1004352022 6:14898384-14898406 CAGGACTCCTGGTCAAAGAAAGG - Intergenic
1006020121 6:31112782-31112804 CAGGACACCTGGGCCAAGAAGGG - Intergenic
1007310000 6:40937882-40937904 AAGGTTCCCTTGGGAAAGGATGG + Intergenic
1011047313 6:83098936-83098958 CAGGACCCCTTCTGAAATAGGGG + Intronic
1011172569 6:84522201-84522223 ATGGGCCCCTTGGGGAAGAAGGG + Intergenic
1011657028 6:89561395-89561417 CAGGACTATTTGCGAAAGAAGGG - Intronic
1012106676 6:95170038-95170060 CAGGTCCTCTTGGGAAGGGAGGG + Intergenic
1012718959 6:102716551-102716573 CAGGACACCTGGGGATAGGAGGG + Intergenic
1015475566 6:133656064-133656086 GAGGTCTCCTTGGGAAAGGATGG - Intergenic
1016690191 6:146929127-146929149 AAGGTGCCCTTGGGAAAAAAGGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019020697 6:168915251-168915273 CAGGACAGCTTGGGAGAGAGAGG + Intergenic
1019425841 7:976144-976166 CAGGACACCATGGGAACGTAGGG - Intergenic
1021981610 7:26060857-26060879 GAGGAGCCCATGGGAAAGGACGG - Intergenic
1023401446 7:39794902-39794924 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1023654858 7:42409270-42409292 AAGGAGTCCTTGAGAAAGAAAGG + Intergenic
1024075425 7:45815546-45815568 CAGCCCCTCTGGGGAAAGAAAGG + Intergenic
1024136224 7:46411986-46412008 CAGGACCCCTTCTGAAATAAGGG + Intergenic
1024648171 7:51385776-51385798 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1024782977 7:52873918-52873940 CAGGCCCCTTTGGGGAAGAGTGG + Intergenic
1025052030 7:55740261-55740283 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1025128988 7:56365929-56365951 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028491217 7:91414261-91414283 CAGGATCCCTTGAGGAAGGACGG + Intergenic
1029932442 7:104386687-104386709 TAGGACCTCTTGGCAAAGAATGG + Intronic
1029956236 7:104643223-104643245 CAGGAAAGCTTGGTAAAGAAGGG - Intronic
1031006746 7:116482214-116482236 CAGGACCCTGGGGGAAATAACGG - Intronic
1031399382 7:121313635-121313657 CAGAACCCCTGGGGCAAGGAGGG + Intergenic
1031474643 7:122206760-122206782 GAGGTCTCCTTGGGAAAGGATGG + Intergenic
1031598727 7:123677566-123677588 CATGACCAATTGTGAAAGAATGG - Intergenic
1031823734 7:126535800-126535822 CAGCAGCCCTGTGGAAAGAATGG + Intronic
1032051943 7:128655271-128655293 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1032431805 7:131868185-131868207 CAGGACCCCTTCTGAAATGAAGG + Intergenic
1032522440 7:132556008-132556030 TAGGACCCCTAGGCCAAGAATGG - Intronic
1034456871 7:151175410-151175432 CAGGAACCCTTGGGGTAGGAAGG - Intergenic
1036371696 8:8168028-8168050 GGGGACCATTTGGGAAAGAAGGG + Intergenic
1036787584 8:11698092-11698114 CAGGACCTCCTGGGAGAGGACGG - Intronic
1036879207 8:12497616-12497638 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1037567698 8:20131273-20131295 CAGCAACCCTGGGGAAGGAAGGG + Intergenic
1037666493 8:20974191-20974213 CAGGGACTCATGGGAAAGAATGG + Intergenic
1039487648 8:37924218-37924240 CAGAGCCCCTTGGCAAAGACTGG - Intergenic
1042215074 8:66423100-66423122 CAGGACCCCTTCTGGAATAAGGG - Intergenic
1043271439 8:78339118-78339140 CAGGACCCTTAGAGAAAGCAGGG + Intergenic
1045952414 8:107866360-107866382 CAGGGGCCCTTGGGGAAGGAAGG - Intergenic
1046603756 8:116347798-116347820 CATAACCTCTTTGGAAAGAATGG - Intergenic
1046738368 8:117801827-117801849 CAGCACCCTTTGGGAATGAGTGG - Intronic
1047334000 8:123919111-123919133 GAGAACTCCTTGGGAAGGAAGGG + Intronic
1047474594 8:125214493-125214515 CAGGACCCTACGTGAAAGAAAGG + Intronic
1048307759 8:133295981-133296003 CAGGACCCCCAGGGACAGCAGGG + Intronic
1048438881 8:134445158-134445180 AAGGAGCCCTTGGGAAAGGCAGG + Intergenic
1048844508 8:138594105-138594127 CAGGGCCCCCTGGAAAAGATGGG - Exonic
1049176793 8:141197692-141197714 CAGGACCCCGTGGCATGGAAAGG + Intergenic
1050614980 9:7392584-7392606 CTGTACCCCTTGCAAAAGAAAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053071731 9:35105975-35105997 CTGAACCCCTTGGGGAGGAAGGG - Exonic
1053184012 9:35999631-35999653 CAGGGCACTTTGGCAAAGAAGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057468605 9:95338076-95338098 CAGGACCCCTTGGCTGTGAAAGG + Intergenic
1057928190 9:99171063-99171085 CAGTTGCCCTGGGGAAAGAAGGG - Intergenic
1059476346 9:114551018-114551040 GAGGGCCCCTTGGAAAAGGAAGG - Intergenic
1061661636 9:132134082-132134104 CAGAATGCCTTGGGAAAGGAGGG - Intergenic
1062574859 9:137201261-137201283 GAGGACCCCTGGTGAAAGCAGGG - Intronic
1062754683 9:138280866-138280888 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1203578590 Un_KI270745v1:25026-25048 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1185936497 X:4262633-4262655 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1191901109 X:66041355-66041377 GAGGACCCGGTGGGAAAAAATGG - Intergenic
1192187132 X:68955333-68955355 CAGAACCCTTTGGCAAAGACTGG + Intergenic
1192561260 X:72129621-72129643 CAGGGCCACCTGGGAAAGGAGGG - Exonic
1194041332 X:88945317-88945339 CAAAACCCCTGGGGAGAGAATGG + Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1195084141 X:101398386-101398408 CAGGACCCCTTGGGCAAGCAAGG - Exonic
1195281443 X:103338495-103338517 GAGAACCCCTTGGTAAAGTAGGG - Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198948226 X:142039603-142039625 CAGGTCCCCTTGGCAAACATTGG + Intergenic
1199894198 X:152116278-152116300 CAGGTCCTCTTGGGAAGGACAGG + Intergenic
1199930093 X:152509155-152509177 AAGATCCCCTAGGGAAAGAAGGG + Intergenic
1200215440 X:154366170-154366192 CAGGACCCCATGGGACAGAAGGG - Exonic
1201720783 Y:17094534-17094556 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1202381227 Y:24277646-24277668 CAGCCCCTCTGGGGAAAGAAGGG + Intergenic
1202489558 Y:25392480-25392502 CAGCCCCTCTGGGGAAAGAAGGG - Intergenic