ID: 1162322817

View in Genome Browser
Species Human (GRCh38)
Location 19:9979873-9979895
Sequence CAGGGTCACCAAGGTAAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162322817_1162322830 3 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322830 19:9979899-9979921 GATGAGGTGGGAAAAAGTTGGGG 0: 1
1: 0
2: 2
3: 34
4: 315
1162322817_1162322828 1 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322828 19:9979897-9979919 GGGATGAGGTGGGAAAAAGTTGG 0: 1
1: 0
2: 1
3: 45
4: 494
1162322817_1162322825 -9 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322825 19:9979887-9979909 GTGACCCTGGGGGATGAGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 846
1162322817_1162322824 -10 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322824 19:9979886-9979908 GGTGACCCTGGGGGATGAGGTGG 0: 1
1: 0
2: 5
3: 55
4: 515
1162322817_1162322832 16 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322832 19:9979912-9979934 AAAGTTGGGGCACAGATACAGGG 0: 1
1: 0
2: 0
3: 13
4: 253
1162322817_1162322829 2 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322829 19:9979898-9979920 GGATGAGGTGGGAAAAAGTTGGG 0: 1
1: 0
2: 2
3: 35
4: 349
1162322817_1162322831 15 Left 1162322817 19:9979873-9979895 CCATCTTTACCTTGGTGACCCTG 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1162322831 19:9979911-9979933 AAAAGTTGGGGCACAGATACAGG 0: 1
1: 0
2: 1
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162322817 Original CRISPR CAGGGTCACCAAGGTAAAGA TGG (reversed) Exonic
900177712 1:1298175-1298197 CCGGGTCTCCAAGGTGAAGCAGG - Intronic
900541066 1:3203079-3203101 TGGGGTCACCAAGATAAAGCAGG + Intronic
901478388 1:9506477-9506499 CGGGGACAGCAAGGTCAAGAAGG + Intergenic
903511611 1:23879957-23879979 CTGGGTCACCAAGGGAATCATGG - Intronic
905861286 1:41353718-41353740 CAAGGTCACCAAGTTACAGCCGG + Intergenic
907516882 1:54998456-54998478 CAAGGTCACACAGCTAAAGATGG - Intergenic
907702293 1:56800974-56800996 CATGGTGACCAAGGTAAATGGGG - Intronic
908651119 1:66334234-66334256 TAGAGTCACCAAGATAAAGCAGG + Intronic
908745460 1:67372141-67372163 CAGGATCACCATGATTAAGAAGG - Intronic
910646048 1:89516448-89516470 CAGGGTCCCCAAGGACAAAAAGG - Intergenic
911525499 1:98980010-98980032 CAGGAAAACCAAGATAAAGATGG - Intronic
912035823 1:105311763-105311785 AAGTGTCAGGAAGGTAAAGAAGG + Intergenic
913093465 1:115495373-115495395 CAGGGTCACGTAGGTATAGAAGG + Intergenic
913322507 1:117598904-117598926 CAGGGTCTCCGAGGAAACGAAGG - Intergenic
915550003 1:156626250-156626272 CAGGGCCACCAAGGCAAATGGGG + Intergenic
916564619 1:165962873-165962895 CAGGGTCACCAGGTCCAAGAGGG - Intergenic
917281505 1:173381518-173381540 CAAGGCCACCAAGCTACAGACGG + Intergenic
919894549 1:202001238-202001260 CAGGGACAGCAAGGCCAAGAAGG - Intronic
920351223 1:205339291-205339313 CAGGGTCACAAAGCTGGAGAAGG + Exonic
921518247 1:216124829-216124851 AAGGGTTACCAGTGTAAAGAAGG + Intronic
924157518 1:241194730-241194752 GAGAGCCATCAAGGTAAAGAGGG + Intronic
924309263 1:242722862-242722884 CATGGTCACCAAGGAAAGAATGG - Intergenic
1064320161 10:14297428-14297450 CAGGGTCAAAAAGGCAGAGAGGG + Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1068687077 10:59881409-59881431 CTGGGACACCAAGATAAAGAAGG - Intronic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1070750572 10:78961813-78961835 CAGGGACACCAAGGCACAGTGGG + Intergenic
1073072064 10:100800782-100800804 CAGGGCCACCCAGGAATAGATGG + Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1076016861 10:127034839-127034861 CAGGGTCATAAGGGTTAAGAAGG - Intronic
1077097324 11:804621-804643 CTGGGTCACCACTGGAAAGAGGG + Intronic
1077859994 11:6169535-6169557 ATGGGTCAATAAGGTAAAGAAGG + Exonic
1078641623 11:13102108-13102130 CAGAGTCAGAAAGGAAAAGAAGG - Intergenic
1079933745 11:26593911-26593933 CAAGGTTACCAAGTTAAATAGGG + Intronic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083309471 11:61777037-61777059 CAGGGTCTCCACAGTAAAGCAGG + Intronic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1085995765 11:81911558-81911580 AAGGGTGACGAAGGTAAAAATGG - Intergenic
1086472327 11:87128200-87128222 GGGGGTCATCAAGGTATAGAAGG - Intronic
1088742537 11:112778754-112778776 CACGGGCACCAAGATAAAGACGG + Intergenic
1089110966 11:116055740-116055762 CAGAGTTACCATGATAAAGAGGG + Intergenic
1090282557 11:125468733-125468755 CAGGCTGCCCAAGGTAAAGGGGG + Intronic
1090538062 11:127667812-127667834 CAGGCTAACCAAGGAAAAAAGGG + Intergenic
1091615946 12:2051921-2051943 TAGGGTCACCCAGGGAATGAGGG + Intronic
1092131914 12:6118813-6118835 TGGGGTCACCAAGGTAGGGAGGG + Intronic
1092239217 12:6827179-6827201 CAGGGTCAGCTGGGGAAAGATGG - Exonic
1096994356 12:55829641-55829663 CGGGGTCACCAGGGAAGAGACGG + Intronic
1098848050 12:75562026-75562048 CAGGGTCACATAGCTACAGAGGG - Intergenic
1099142644 12:78997894-78997916 CAGGATCACTAAGAGAAAGATGG - Intronic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102862764 12:116350821-116350843 CTGGGTGACCAAGGAAAAGCCGG + Intergenic
1103334412 12:120178525-120178547 TAGGGTCACCAGGGCAAAGCAGG + Intronic
1103365658 12:120381032-120381054 TAGAGTAACAAAGGTAAAGAAGG + Intergenic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1107518693 13:41158253-41158275 CCAGGTCACCAAGGTGAAAAGGG + Intergenic
1108532688 13:51342318-51342340 CAGTGTCACCCAGGTATAGGTGG - Intronic
1110451873 13:75645947-75645969 CAGGGTCAGGAATGTAAATATGG - Intronic
1117218231 14:53574196-53574218 CACTGTCACCAAGGAACAGATGG - Intergenic
1117338594 14:54775345-54775367 CAGGGTCCCCAAGGTTAAAGTGG - Intronic
1121279589 14:92689079-92689101 CAGGATCCCCATGGCAAAGAGGG - Intergenic
1127828851 15:62731751-62731773 CCAAGGCACCAAGGTAAAGAGGG - Intronic
1128907209 15:71477783-71477805 CAGGTTCAGCATGGTGAAGAGGG - Intronic
1131011119 15:89019280-89019302 CAGGGTCAACAATGCAAAGCAGG + Intergenic
1131051223 15:89349384-89349406 CTGTGTTTCCAAGGTAAAGACGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1134607514 16:15582747-15582769 AAGGATCACCAAGATAAAGTAGG - Intronic
1138710112 16:58961637-58961659 AAAGGTCACCAAGGCAAGGAGGG - Intergenic
1139968330 16:70757997-70758019 CAGTGTCACCTGGGTAGAGAAGG + Intronic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1143691696 17:8572677-8572699 CAGAGTCACCATGGTAATGGTGG + Intronic
1144115271 17:12083198-12083220 AAAGGTCATAAAGGTAAAGAGGG + Intronic
1144598708 17:16594118-16594140 CAGGGACAGAAAGGCAAAGATGG + Intergenic
1146592731 17:34142169-34142191 CAGGGACACCAAGGAAAAAGTGG + Intronic
1146816526 17:35946957-35946979 CAGGATCACCAAGGGCAACAAGG + Intergenic
1146913763 17:36665119-36665141 CGGGGTCCCCAAGGGAGAGATGG + Intergenic
1149062446 17:52438755-52438777 AAGGGTCAGTAAGATAAAGAAGG - Intergenic
1153427936 18:4987271-4987293 GAGGGTTAGCAAGGTGAAGAGGG + Intergenic
1154241786 18:12658770-12658792 CAGGGTAAGCACCGTAAAGACGG + Exonic
1155760189 18:29555632-29555654 CATCATCAACAAGGTAAAGAAGG + Intergenic
1156555382 18:38062208-38062230 CAGGGTCACTAAGCAAAGGAAGG - Intergenic
1156748383 18:40419862-40419884 CAAGGTCACCAAGGTTATGCAGG + Intergenic
1157827939 18:50829793-50829815 CAGGGTAACCAAGGCAAATCTGG - Intergenic
1157966177 18:52210966-52210988 CAGGGTCATCTCCGTAAAGAAGG - Intergenic
1161607947 19:5225181-5225203 CAGGGCCACCAAGAGAAAGGTGG + Intronic
1161962369 19:7529818-7529840 CAGGGTCACCAAGGACCACAGGG - Intronic
1162095960 19:8310052-8310074 CAGGGTGACCATGGTCAAGCAGG + Intronic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1162324236 19:9989347-9989369 CAGGGTCACCCAGGACATGAGGG - Exonic
1163961599 19:20700794-20700816 CAGGGTTTCCAAGGCAATGAAGG + Intronic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1166147282 19:40846291-40846313 GATGGTCAGCAAGGTAAAGAAGG - Intronic
1166151434 19:40878187-40878209 GATGGTCAGCAACGTAAAGAAGG - Intronic
1167685974 19:50956817-50956839 CAGGGAAACCAAGGCACAGAGGG - Intergenic
1168110942 19:54191077-54191099 CAGGGTCACAAGGGTAGAGCGGG + Intronic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
925910949 2:8573423-8573445 CAGGGCCACCCAGGTAATGAGGG + Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926341869 2:11910431-11910453 ATGGGACACAAAGGTAAAGATGG - Intergenic
928784706 2:34869101-34869123 CAAGGTCAGCAATGTAATGAGGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930146743 2:48015056-48015078 CAGGGTCTCCCAGATGAAGAGGG + Intergenic
931721875 2:65072598-65072620 CAGGGTAACCAAGGTAGAAATGG - Exonic
932190004 2:69732908-69732930 CATGGTCTCCAAGGAAAAGGTGG - Intronic
932743494 2:74311187-74311209 CAGGCTAACCAAGGAAAAAAGGG - Intronic
935181150 2:100692224-100692246 CAGAGTCACAAAGTTATAGATGG - Intergenic
936350269 2:111707089-111707111 CTGGGGCACCAAGGTGAGGAGGG + Intergenic
936929235 2:117769958-117769980 TGGGGTCACCCTGGTAAAGAGGG + Intergenic
937452049 2:122010068-122010090 CAGGGGCAGCAATGTAGAGACGG - Intergenic
937523868 2:122743492-122743514 GAGGGGTACCAAGGAAAAGAGGG - Intergenic
937896514 2:126980291-126980313 CACGGCCACCCAGCTAAAGATGG - Intergenic
937905496 2:127050964-127050986 CAGGGCCACCGAGGAGAAGAGGG + Intronic
941006116 2:160248818-160248840 CAGGCTCACCAGGGCAGAGAGGG + Intronic
941095961 2:161239279-161239301 CAGGGCCACAAAGGCCAAGAAGG + Intergenic
942997914 2:182287048-182287070 CAAGTTCAGCAAGGTAAAGCAGG - Intronic
948862329 2:240758615-240758637 CAGGGTCATCAAGGTCCAGGGGG + Intronic
1174201062 20:48806793-48806815 CAGGGATACCAAGGTCAAGATGG + Intronic
1179361962 21:40718194-40718216 CAGTTTCACTAACGTAAAGAGGG + Intronic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
950291866 3:11791196-11791218 CAGGGCCACCTAGGTGAACAGGG - Intronic
950859833 3:16138123-16138145 CAGGGTCAGCAAGGACAAAAAGG - Intergenic
951989827 3:28664262-28664284 CAGAGTCTCCAATGTAAACAAGG + Intergenic
952287369 3:31981489-31981511 CAGGGACACGAAGGAAGAGAAGG - Intronic
954819729 3:53315335-53315357 CAAGGTCAGCCAGGTCAAGATGG + Intronic
954898909 3:54002124-54002146 CAGCGTTTCCAAGGTGAAGAAGG + Intergenic
958150918 3:89693550-89693572 CTGGGAGACCAAGGAAAAGAAGG + Intergenic
958898334 3:99855527-99855549 GAGGCTCACAAAGGTCAAGAAGG + Intronic
965729447 3:171755277-171755299 CAGTGGCAGCAAGTTAAAGAAGG - Intronic
966255317 3:177910169-177910191 CAGATTCACCAAGGTTAAAATGG + Intergenic
966508426 3:180733392-180733414 ATAAGTCACCAAGGTAAAGAAGG + Intronic
969055212 4:4397404-4397426 CAAGGTCACCCAGCTAATGAGGG + Intronic
971706690 4:30052997-30053019 CATGGTAGCCAAAGTAAAGAGGG + Intergenic
974509521 4:62820267-62820289 CAGTGTTACCAAGGTAAGCAAGG + Intergenic
983503875 4:168531386-168531408 CAGGATATCCCAGGTAAAGATGG + Intronic
984752840 4:183295528-183295550 CAGCGTCACCAAGGCACAGCTGG - Intronic
986447867 5:7838702-7838724 CAGGGTCAGCCAGGTCAGGAGGG - Intronic
986549543 5:8937255-8937277 CAGATTCTCCAAGGTAAATATGG + Intergenic
992838875 5:80668000-80668022 GAGGGTGAGCAAGGCAAAGAGGG + Intronic
992927343 5:81602382-81602404 CAGGGAGCCCAAGGTAGAGAAGG - Intronic
993070907 5:83162297-83162319 CAGGGTAACCAACTTTAAGAGGG - Intronic
993744672 5:91582765-91582787 CAGGGTCACCAAGGCCAACTGGG - Intergenic
995753806 5:115480352-115480374 CAGGGTTACCAAGGTACTGCTGG - Intergenic
997299024 5:132788874-132788896 CATGGGCATGAAGGTAAAGAAGG + Intronic
999366688 5:151028055-151028077 CACGGTCAGCAACGTCAAGATGG + Exonic
999516803 5:152310085-152310107 CAAGGGCAGCTAGGTAAAGATGG - Intergenic
1001009811 5:168087278-168087300 CAGGATCACCCAGGAAAAGATGG - Intronic
1002057359 5:176606139-176606161 CAGGGTCCCCAAGGAGGAGAAGG - Intronic
1002302168 5:178263305-178263327 CAGGGAGACCAAGGACAAGATGG - Exonic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1005591010 6:27327319-27327341 CAGGGACACGGAGGTAAAGCAGG - Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1008191539 6:48464023-48464045 AAGGGTCACTGGGGTAAAGAAGG + Intergenic
1009843179 6:69102634-69102656 CAGGGCCACCAAGGTAGAACTGG + Intronic
1010731282 6:79394211-79394233 GGGAGTCAACAAGGTAAAGAGGG - Intergenic
1010847755 6:80731900-80731922 CTGGATTACCAAGGTAAATAGGG + Intergenic
1011377474 6:86705559-86705581 CAGATTCTCCAAGGTAAAAATGG - Intergenic
1012027763 6:94019681-94019703 CAGAGCCACCAAAGTAGAGATGG - Intergenic
1013654398 6:112230407-112230429 CAAGGTCACCCAGGTAGAGCTGG - Intronic
1014211389 6:118711934-118711956 CAAGGTCACCAAGTTACAGGTGG - Intergenic
1016130057 6:140456951-140456973 CACTGTCACCATGGGAAAGAGGG + Intergenic
1018340654 6:162847617-162847639 CGTGGTCCCCAAGGTAAAAAGGG + Intronic
1019514636 7:1434323-1434345 CAGGGGCACCGAGGCAAACACGG + Intronic
1022826066 7:34015224-34015246 CAAGGTCACACAGGAAAAGAGGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1031499927 7:122501538-122501560 CAAGGTCACCCAGATAAAAAGGG + Intronic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1036130322 8:6103796-6103818 CAAGGTAAACAAGGTAAACAAGG + Intergenic
1036725572 8:11217839-11217861 CAGGGTCACCTAGGTGATGTGGG - Intergenic
1037882721 8:22580685-22580707 CATGGTGACTAAGGTAAGGATGG + Exonic
1039905274 8:41781797-41781819 GAGGGTCTCCAAGGCCAAGAGGG + Intronic
1040832421 8:51692090-51692112 CAGGGTGGCCTAGGTAAAGAGGG - Intronic
1041956153 8:63559553-63559575 GAGGGTGAGCAAGGCAAAGAGGG + Intergenic
1043552413 8:81389711-81389733 CAGGGTCAGGAAAGTAAAGGAGG - Intergenic
1043770119 8:84187074-84187096 GAGGGTTTCCAAGGTAAAGGTGG + Intronic
1043940646 8:86191887-86191909 CAGGGGCACCAAGGTAGACAAGG - Intergenic
1044240384 8:89881438-89881460 CATGGTCACCAGGGAAAAGTTGG + Intergenic
1044754019 8:95443257-95443279 CAATGTCACCGAGTTAAAGAAGG + Intergenic
1045184478 8:99823177-99823199 CAAGGTCACAAAGATGAAGAGGG - Intronic
1047854948 8:128899174-128899196 TAGGGTTACCAAGGTAACCAAGG + Intergenic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1049969250 9:807273-807295 CAAAGTCACCAAGGTAGAAATGG + Intergenic
1051752782 9:20361098-20361120 TAGGGTCACACAGGTAAAAATGG + Intronic
1056692420 9:88819167-88819189 CAGCGGCACCAAGGTTAAGGTGG + Intergenic
1058061737 9:100504397-100504419 CAGTGTCACCAAGTGACAGATGG + Intronic
1059842860 9:118237717-118237739 CAGGCTAAGCAAGGTAAAAAAGG + Intergenic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060697089 9:125718613-125718635 CAGGTTCTCCCAGGTGAAGAGGG - Intergenic
1060801337 9:126547648-126547670 CAGGGAAACCAAGGTACACAGGG - Intergenic
1061721912 9:132557167-132557189 CAGGGGCTCCAAGGTGCAGACGG + Intronic
1062109180 9:134772787-134772809 CAGGGACACCCTGGCAAAGAAGG + Exonic
1186380860 X:9057296-9057318 CAGGGTCTACAAAGCAAAGACGG - Intronic
1186761001 X:12721429-12721451 CAGGGCAACCAAGGAGAAGAGGG + Exonic
1189995880 X:46637234-46637256 CAAGGTCACAAAGGTAGAAATGG + Intronic
1194806717 X:98338172-98338194 CAAGGTGACAAAGGTGAAGATGG - Intergenic
1196140167 X:112252846-112252868 CAGGATCACCAAGGTATAAAAGG - Intergenic
1198310632 X:135424097-135424119 CTGGGGCACCAAGGGAGAGAGGG + Intergenic
1199163442 X:144642506-144642528 CAGGGGCACCAACCAAAAGAGGG + Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic
1202056561 Y:20839285-20839307 CAGAGCCACCAGGCTAAAGAAGG - Intergenic