ID: 1162326049

View in Genome Browser
Species Human (GRCh38)
Location 19:10000299-10000321
Sequence GACATGCTCCATTTTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162326049_1162326055 21 Left 1162326049 19:10000299-10000321 CCAAGACCAAAATGGAGCATGTC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1162326055 19:10000343-10000365 CGTCCCTCCCATCTTCCTCCAGG 0: 1
1: 0
2: 3
3: 42
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162326049 Original CRISPR GACATGCTCCATTTTGGTCT TGG (reversed) Intronic
903923076 1:26815003-26815025 GACCTGCTCCATTTCTGACTTGG - Intergenic
905250995 1:36648276-36648298 CACATGCTCCACTTTGAGCTGGG + Intergenic
907647162 1:56255624-56255646 CATATGCTCCATATTGGCCTTGG + Intergenic
907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG + Intronic
908734792 1:67264882-67264904 TAAATGGTCCATTTTTGTCTGGG + Intergenic
909092927 1:71248865-71248887 AACATACTCCATATTGGTATAGG + Intergenic
910203651 1:84725656-84725678 GAGATTCTCCATTTTGTTCAAGG + Intergenic
910390325 1:86736360-86736382 GACGTGCTCAATTTTATTCTAGG - Intronic
915760895 1:158311574-158311596 GGAATGCTTCATGTTGGTCTGGG - Intergenic
917104320 1:171477237-171477259 GCCATGCTCCATTTGGCTTTTGG + Intergenic
917726749 1:177835184-177835206 GACATAATCCATTTTGGCTTTGG - Intergenic
920688140 1:208125544-208125566 GGCATGCTCCAATTTGCACTAGG + Intronic
921437175 1:215137332-215137354 GACATGCTTGATTTTGCTCATGG - Intronic
922538944 1:226404511-226404533 GACCTGCTGCCCTTTGGTCTGGG + Intronic
1067156233 10:43783326-43783348 GATTTGCTCCATCTTGGGCTAGG - Intergenic
1071318756 10:84430331-84430353 GAAATGCTCCAATATAGTCTTGG - Intronic
1073382203 10:103087322-103087344 GAGAGGCACCATTTTGCTCTGGG + Exonic
1073621428 10:105052884-105052906 GTTCTGCTCCAGTTTGGTCTGGG + Intronic
1074923848 10:118046913-118046935 GGCCTTCTCCATGTTGGTCTCGG + Intergenic
1075959333 10:126554434-126554456 GACATACTCTATTTTGATTTGGG + Intronic
1077259116 11:1606287-1606309 AACATGCTGGACTTTGGTCTAGG + Intergenic
1078729403 11:13962199-13962221 GACATGTTCCACTATGGCCTTGG + Intergenic
1083013167 11:59423503-59423525 GACATATTCCATTTTGGTGGAGG + Intergenic
1091032349 11:132202176-132202198 GACATTCTCCATGATGGTTTTGG + Intronic
1092648195 12:10602885-10602907 GACATCCTTCATTTTAGTCTGGG - Intergenic
1094043033 12:26137314-26137336 GAAATGCTGAATTTTTGTCTGGG - Intronic
1095764010 12:45874221-45874243 GACTTGCTCCATTTCTGACTTGG - Intronic
1096885696 12:54716984-54717006 GACATCCTGGATTCTGGTCTTGG - Intergenic
1097243359 12:57591366-57591388 GAAATGCTTCTTCTTGGTCTTGG - Exonic
1099382013 12:81966618-81966640 GACAAGTTCCATTTTCTTCTAGG - Intergenic
1100013682 12:89983317-89983339 AAGATGCTCCATTTCAGTCTTGG - Intergenic
1102678605 12:114674777-114674799 GCCATGCTCCTCTTTGCTCTCGG + Exonic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1105805583 13:23950098-23950120 GACATGCTCCAGTGTTGTCCTGG - Intergenic
1106256867 13:28030158-28030180 GACATCCTCTATTTTGGTTTGGG + Intronic
1108186673 13:47894817-47894839 GACGGGCTGCAATTTGGTCTTGG - Intergenic
1108526271 13:51288418-51288440 GAGATGCTCCTTATTGGTGTAGG - Intergenic
1109436230 13:62307118-62307140 CACATCTGCCATTTTGGTCTAGG - Intergenic
1110532135 13:76610024-76610046 AACATGGTCCATTTTAGCCTGGG - Intergenic
1116193983 14:41698505-41698527 CACAGGCTCCAATTTAGTCTAGG - Intronic
1118075847 14:62298020-62298042 GAATTGCTTCATCTTGGTCTAGG + Intergenic
1118815779 14:69312960-69312982 GACAGCCTCAATTTTGGTCCCGG + Intronic
1120242822 14:81969760-81969782 TTCACGCTCCATTTTGGTTTTGG - Intergenic
1123415975 15:20095817-20095839 GACCTGCTCCATTTTCATCCTGG + Intergenic
1123525315 15:21102927-21102949 GACCTGCTCCATTTTCATCCTGG + Intergenic
1125001633 15:34776896-34776918 GACTCACTCCATTTTGGTTTGGG - Intergenic
1126221208 15:46215726-46215748 GACATTCTCTATTTTCTTCTGGG + Intergenic
1126452600 15:48825830-48825852 GACCTGGTCCATGATGGTCTTGG + Exonic
1128724349 15:69976763-69976785 CACCTGGACCATTTTGGTCTGGG + Intergenic
1129597632 15:76976999-76977021 GACCTGCTCCATTTTGGATCTGG + Intergenic
1130291427 15:82605178-82605200 GACAAACTCCCTTTTTGTCTAGG - Intronic
1131423728 15:92328507-92328529 CCAATGCTCCATTTTGGTCTAGG - Intergenic
1134512939 16:14863539-14863561 GGGAAGCTCCATTTTGGCCTGGG - Intronic
1134599754 16:15524087-15524109 CACATGCTTCATTTTGCCCTTGG - Intronic
1134700577 16:16262028-16262050 GGGAAGCTCCATTTTGGCCTGGG - Intronic
1134971249 16:18532631-18532653 GGGAAGCTCCATTTTGGCCTGGG + Intronic
1136102373 16:28005488-28005510 GACATACTCCATATTGGATTAGG + Intronic
1138317350 16:56081540-56081562 GACAGGCTCCAGTATGGTGTAGG - Intergenic
1139449716 16:67019708-67019730 GACCTGCTCCATTTTCGACCTGG - Intergenic
1141671978 16:85496872-85496894 CACGTGCCCCCTTTTGGTCTGGG + Intergenic
1143689241 17:8547002-8547024 GACCTGCTCCATTTTCAACTTGG + Intronic
1143718380 17:8792630-8792652 AGCGTGCTCCATTTTGGTCCCGG - Intergenic
1145828640 17:27897257-27897279 GACCTGCTCCATTATGGGGTGGG - Intergenic
1146827090 17:36032233-36032255 GAGATGGGCCACTTTGGTCTGGG + Intergenic
1147200627 17:38799341-38799363 GAAATGCTTCTTCTTGGTCTTGG + Exonic
1148584174 17:48765641-48765663 GACCTGCTCCATTTCTGTCTTGG + Intronic
1148943187 17:51233690-51233712 TGGATGCCCCATTTTGGTCTTGG - Intronic
1150651135 17:67010931-67010953 GACATGGTCCATTTGGCCCTTGG + Intronic
1150656785 17:67044665-67044687 GACCTTCAGCATTTTGGTCTGGG - Exonic
1152311301 17:79551607-79551629 GCCATCCTCCATTTGGGTCATGG + Intergenic
1159939530 18:74396121-74396143 GACATGCTCCAGGTTGGTCCTGG - Intergenic
1161894429 19:7069613-7069635 GACACGCCGCATTTTGGGCTGGG + Exonic
1162326049 19:10000299-10000321 GACATGCTCCATTTTGGTCTTGG - Intronic
927293452 2:21426832-21426854 GACTGGCTGCATTTGGGTCTTGG - Intergenic
928413492 2:31072097-31072119 GAAATGCTCCTTTTTGCTCTGGG - Intronic
931580702 2:63769488-63769510 AATATGGTCCATTTTGGTCAAGG - Intronic
932417892 2:71584661-71584683 TACATGCTCGATGTTGGACTGGG + Intronic
936148912 2:109999864-109999886 TACACGCTCCTTTTTGGTTTAGG - Intergenic
936195769 2:110371504-110371526 TACACGCTCCTTTTTGGTTTAGG + Intergenic
938270733 2:129968251-129968273 GACATCCTCAAGTTTGGTTTTGG + Intergenic
944591145 2:201218972-201218994 GTCATATTCCATTTTGGACTGGG + Exonic
946735690 2:222752192-222752214 AATCTGCTCCACTTTGGTCTTGG + Intergenic
948253901 2:236552142-236552164 GACCAGCACCATTTTGCTCTGGG - Intergenic
1170844723 20:19952731-19952753 GACACTGTCCAATTTGGTCTTGG + Intronic
1170902325 20:20477110-20477132 AACATCCTCTATTTTGATCTGGG + Intronic
1172580053 20:36040061-36040083 GACTTCCTCCATTTTCTTCTTGG - Intergenic
1173176947 20:40771769-40771791 GGCCTGCTCCAGTTTGGGCTGGG - Intergenic
1182543715 22:31060179-31060201 GACCTGCTCCATTTTCATCTTGG - Intergenic
1184782021 22:46654340-46654362 CACATGCTCCATGCTGCTCTTGG + Intronic
949165181 3:931861-931883 GACATGGTCCAATGTGGTTTGGG - Intergenic
950090910 3:10293665-10293687 GACTTGCTTCATTGTGGTCTGGG - Intronic
950360071 3:12443858-12443880 GACATGCTCTTTATTGGACTAGG + Intergenic
951310309 3:21117257-21117279 AACAAGCTCCTTTTTGGCCTAGG + Intergenic
958584239 3:96065898-96065920 GACATGCTCCATATTGATTTAGG + Intergenic
960551111 3:118977382-118977404 GGCATGTTCTAGTTTGGTCTTGG + Intronic
971374988 4:26049472-26049494 GACAGACTCCATTCTGGTTTGGG + Intergenic
973929178 4:55772499-55772521 AAAATGTTCCATTTAGGTCTTGG - Intergenic
973963363 4:56134390-56134412 TACAGGCCCCAGTTTGGTCTTGG - Intergenic
974033157 4:56794435-56794457 GACCTGCTCCATTTTCGACCTGG + Intergenic
974300451 4:60059233-60059255 GACCTGCTCCATTTCTTTCTTGG + Intergenic
976328347 4:83798764-83798786 GTGATGCTCCAATCTGGTCTTGG - Intergenic
986819801 5:11453612-11453634 GAAAGTCTCCATTTTGGTTTGGG + Intronic
987296668 5:16559022-16559044 TAAATGCTCCAATTTGTTCTGGG + Intronic
987569302 5:19634743-19634765 GAGTTTCTCCATTTTGGTCAAGG - Intronic
987926443 5:24348693-24348715 AAGATGTTCCATTTTGTTCTAGG + Intergenic
991065763 5:62423081-62423103 GATATGCTCCATTTCAGTATAGG + Intronic
991328023 5:65459547-65459569 GACATTCTCCCTTTTGGTTTAGG + Intronic
994465544 5:100124808-100124830 GACATTATCAATTATGGTCTAGG - Intergenic
999531296 5:152466010-152466032 GAAATGGTCCATCTTGTTCTGGG + Intergenic
1008538276 6:52524551-52524573 GAAATACTCTATCTTGGTCTAGG + Intronic
1011505413 6:88036854-88036876 GACATTATCCATTTTCGTCAAGG - Intergenic
1013468562 6:110440092-110440114 GACCTGCTCCATTTTCGACCAGG + Intronic
1015608188 6:134983516-134983538 GACAAGATCCATTTTAGGCTTGG + Intronic
1022041083 7:26582032-26582054 GACTTCCTCCATTTTGCTCTGGG + Intergenic
1023032901 7:36106654-36106676 AACATATTCCATTTTGGACTTGG + Intergenic
1024683261 7:51716826-51716848 GACATGCTCCATTTCTGACCTGG - Intergenic
1027589060 7:80094838-80094860 GGCATGCACCAGTTTGGTTTAGG - Intergenic
1028089924 7:86686229-86686251 GACACGCTCCAGTTTGGCATGGG + Intronic
1029330625 7:99850871-99850893 GATATGCTGCATTTTGCGCTAGG + Intronic
1031012198 7:116536224-116536246 CACTTGCTCCATTATGGACTGGG + Intronic
1033644568 7:143290804-143290826 GACTTGCTCCATTTTTGACCTGG - Intronic
1034416572 7:150968276-150968298 GACATGGTCCCTTCTGGACTTGG - Intronic
1037526299 8:19727669-19727691 GATATTCTCCTTTTTGGTCATGG + Intronic
1039762527 8:40592839-40592861 GACAACCTTGATTTTGGTCTTGG + Intronic
1041981936 8:63872463-63872485 CATATCCTCCATTTTCGTCTAGG + Intergenic
1045908348 8:107375647-107375669 GCCAGGCTCCATATTGGTTTAGG + Intronic
1046632927 8:116639632-116639654 GACCTTCTCCATTGTGATCTAGG + Intergenic
1050946991 9:11535969-11535991 GACATGCTTCAAATTAGTCTTGG - Intergenic
1057104700 9:92401887-92401909 AGCATGTTCCATTTTAGTCTCGG + Intronic
1057819112 9:98317717-98317739 GTCATGCACCATGTTGGTGTGGG + Intronic
1058165256 9:101611822-101611844 GATATGATTCATATTGGTCTGGG + Intronic
1187571134 X:20503506-20503528 GAAAAGCTCTATATTGGTCTTGG - Intergenic
1188362614 X:29274215-29274237 GACATACTGCATTTTGTTCAGGG - Intronic
1194420674 X:93669545-93669567 TACATTCTTCATTTTGGTTTTGG + Intergenic
1196347291 X:114678704-114678726 GACATTATACATTTAGGTCTAGG + Intronic
1197529396 X:127604649-127604671 AAGTTGCTTCATTTTGGTCTTGG - Intergenic