ID: 1162326573

View in Genome Browser
Species Human (GRCh38)
Location 19:10003136-10003158
Sequence TGTCCCCAGTGACCCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162326568_1162326573 7 Left 1162326568 19:10003106-10003128 CCCCAATTAATGACTCTCCCAAT 0: 1
1: 0
2: 1
3: 4
4: 156
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1162326569_1162326573 6 Left 1162326569 19:10003107-10003129 CCCAATTAATGACTCTCCCAATG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1162326567_1162326573 8 Left 1162326567 19:10003105-10003127 CCCCCAATTAATGACTCTCCCAA 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1162326571_1162326573 -10 Left 1162326571 19:10003123-10003145 CCCAATGAATAACTGTCCCCAGT 0: 1
1: 0
2: 1
3: 17
4: 118
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1162326566_1162326573 18 Left 1162326566 19:10003095-10003117 CCAAATAATGCCCCCAATTAATG 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195
1162326570_1162326573 5 Left 1162326570 19:10003108-10003130 CCAATTAATGACTCTCCCAATGA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162326573 Original CRISPR TGTCCCCAGTGACCCCAAGC AGG Intronic
900540775 1:3201637-3201659 TTTCTCCAGTGACCCCTGGCAGG + Intronic
901448694 1:9323349-9323371 AGTCCCCAGTGACTCCATGGAGG - Intronic
901671426 1:10858350-10858372 TGTCCCCAGTGTCCCCTCCCAGG - Intergenic
902656061 1:17869127-17869149 TGTGTCCAGGGAGCCCAAGCTGG - Intergenic
903055776 1:20634968-20634990 TGTCACCTGTCACCCCAAACTGG - Intronic
904304325 1:29577776-29577798 TGTCCACACTGACCCCAACAGGG - Intergenic
906666962 1:47628678-47628700 TGTCCCCAGTGTCCCCAGTTAGG - Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
912278059 1:108281518-108281540 GGCTCCCAGTGACCCCAACCAGG - Intergenic
912290167 1:108412839-108412861 GGCTCCCAGTGACCCCAACCAGG + Intronic
915307240 1:154987618-154987640 TGTCCCCACTGCCACCAAGCAGG - Intronic
916060333 1:161093868-161093890 TGTGCCCGGGGACCCCAAACTGG + Intergenic
917296746 1:173527626-173527648 ACTCCCCAGTGACTCAAAGCTGG - Intronic
918009033 1:180569425-180569447 TGCCAGCAGTTACCCCAAGCTGG + Intergenic
918107343 1:181426131-181426153 TGACCCCAGTGCACCCAAGCTGG - Intronic
920674104 1:208027117-208027139 TGTCCCCTGAGACCCCATCCTGG - Exonic
924011564 1:239670821-239670843 TATCCACAGTCACCCCAAACTGG - Intronic
1067468123 10:46516422-46516444 TGGCCCCAGTGACCACTGGCTGG - Intergenic
1067730657 10:48808855-48808877 TGTCCCCAGGGACCCAGAGGAGG + Intronic
1069827971 10:71265844-71265866 TGTCCCCAGGTCCCCCATGCTGG + Intronic
1069854802 10:71434213-71434235 CCTCCCCAGTGACCCTCAGCTGG + Intronic
1069948136 10:72001378-72001400 GGCCCCCAGTGGGCCCAAGCAGG + Intronic
1071985008 10:91041408-91041430 TGTCCCAACTGACCCCAAACTGG - Intergenic
1075172316 10:120127459-120127481 TGCCCCCAGTGCCACCCAGCTGG - Intergenic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1077489696 11:2855163-2855185 TGCCCCCAGCCACCCCAAGAAGG + Intergenic
1079110955 11:17604961-17604983 TGTCCCCTGTGTCCCCAGGAGGG - Intronic
1080062960 11:27977000-27977022 TGTCCCCAGTCTCCCCAGTCTGG + Intergenic
1083694906 11:64436402-64436424 TGGACCAAGAGACCCCAAGCTGG + Intergenic
1083755046 11:64787854-64787876 TGTCCCCACTTACCCCACCCTGG + Intergenic
1085461304 11:76695526-76695548 TGTACCCAGTGAGCTCCAGCAGG + Intergenic
1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG + Intergenic
1087065604 11:94025282-94025304 TGTCCCCATTTACTCCAAGGAGG - Intronic
1088741447 11:112770641-112770663 TGTGCCCAGTGACCCCACCATGG - Intergenic
1089749004 11:120637003-120637025 GGTCCTCAGAGACCCGAAGCAGG - Intronic
1090423320 11:126590532-126590554 TGTCCACAGTGAGCCACAGCAGG - Intronic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1091756611 12:3056520-3056542 TGGTCCCAGTGACCACAGGCTGG - Intergenic
1093086126 12:14868643-14868665 CGTTCCTAGTGACCCCAACCAGG - Intronic
1094063074 12:26335080-26335102 TGTGCCCACTGAGCTCAAGCAGG + Intergenic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1100567857 12:95815400-95815422 TCTCTCCACTGACCACAAGCCGG + Intronic
1102419782 12:112794409-112794431 TATCCCCAATCACCCCAAACAGG - Intronic
1104974766 12:132547572-132547594 TGTCCCCAGTGACCCCCTGAGGG - Intronic
1111582926 13:90248803-90248825 TGTCCCTAGGGACCCGATGCTGG - Intergenic
1112168884 13:96948888-96948910 TGTCCCCACTGGAACCAAGCCGG + Intergenic
1113246512 13:108402748-108402770 GGTCCCCAGTGTCACCCAGCAGG - Intergenic
1113898538 13:113782746-113782768 TGTCCCCAGAGACCACAGGTTGG + Intronic
1116741102 14:48755754-48755776 TGTCCCCAGTTCACCCAAGGTGG + Intergenic
1117514918 14:56491491-56491513 TATTCCCAGTGACCTCAAGATGG + Intronic
1117875611 14:60248548-60248570 TGACCCCAGGAAGCCCAAGCAGG - Intronic
1118473451 14:66095323-66095345 TGTGCTCAGACACCCCAAGCAGG - Intergenic
1118475567 14:66113438-66113460 TGTCCACAGTAGCCCCAAGCTGG - Intergenic
1119651830 14:76389392-76389414 TGTCCCCAGTGACACAGAGTGGG + Intronic
1119987668 14:79157374-79157396 TTTCCACAGTGACCCCAAGGTGG - Intronic
1120141281 14:80932618-80932640 TGTCTCCCATGACCCCAAGACGG + Intronic
1121124808 14:91399240-91399262 CGACACCAGTGACACCAAGCTGG + Intronic
1121467165 14:94123377-94123399 TGTCTCCAGTGGTCCCCAGCGGG - Intergenic
1126673168 15:51134978-51135000 GGCCCACAGTGACCCCAATCAGG - Intergenic
1128327080 15:66730821-66730843 TTTGCCCAGTGGCACCAAGCTGG + Intronic
1128713993 15:69893708-69893730 AGTCCCCATGGAACCCAAGCAGG + Intergenic
1132606244 16:794934-794956 TGGGCCCAGTGACCCCTTGCTGG + Intronic
1133771630 16:8869817-8869839 TTTCCCCAGTGGCCCCAATAGGG - Intergenic
1136296781 16:29308505-29308527 GGTCTCCAGCGACACCAAGCTGG - Intergenic
1136428947 16:30186119-30186141 TGTCCCAACTGGCCCCAGGCAGG - Intronic
1138431728 16:56973182-56973204 TGTACCCAGTTTCCCCCAGCGGG - Intronic
1139210410 16:65071615-65071637 TGTCCCCAGACACCACAATCTGG + Intronic
1141432149 16:83975828-83975850 TTTTGCCAGAGACCCCAAGCGGG - Intronic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1142205076 16:88779069-88779091 TGTCCCCCAAGCCCCCAAGCTGG + Intronic
1142696391 17:1636145-1636167 TGACCCCAGTCACCCCAACATGG + Intronic
1143012204 17:3872262-3872284 TGGCGCCACTGACCCCAGGCAGG + Intronic
1143165329 17:4894596-4894618 TGTCCCCACTGCCTCCAGGCTGG - Exonic
1143924218 17:10355599-10355621 GGTGCCCAGTGCTCCCAAGCTGG + Intronic
1144829035 17:18121565-18121587 TGCCCCCACTGGCCCCCAGCTGG + Exonic
1145761800 17:27429688-27429710 TGTCTCCAGTGAGCCCATGCAGG - Intergenic
1145963444 17:28901011-28901033 TGACGCCAGTGGCCTCAAGCTGG + Exonic
1146057465 17:29588663-29588685 TGTTCCCAGTCACCACCAGCAGG + Intronic
1147862631 17:43532734-43532756 TGTGCCCATTGACCCCACCCTGG + Exonic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1152023941 17:77796738-77796760 TGTCCCCAGCTGCCCCCAGCAGG - Intergenic
1152214937 17:79026651-79026673 TGTCCCCAGTGAGCTCATTCAGG + Intronic
1152633946 17:81422931-81422953 ATGCCCCAGTGTCCCCAAGCAGG + Intronic
1156277340 18:35596194-35596216 TTTCCCCAGAGACCCCAAATGGG + Intronic
1156387010 18:36614172-36614194 TGTCCCCCATGGCCCCAAACCGG + Intronic
1156462018 18:37326509-37326531 TGTCCTCAGTGTCCCCATGGAGG + Intronic
1157449079 18:47772179-47772201 TGACCCCAGGCAGCCCAAGCGGG + Intergenic
1157692721 18:49697161-49697183 TTTCCCCCATGACCCCAGGCGGG - Intergenic
1158267582 18:55677262-55677284 TGTCCCCAGGGACCCAGAGCAGG - Intergenic
1159022452 18:63154758-63154780 TGTAGCCAGTGCCCCCAAGGAGG - Intronic
1160568020 18:79798748-79798770 CGTCCCCAGTGACCACAGTCCGG - Intergenic
1161362051 19:3855936-3855958 TGTCCCCTGAGACCCCACGGGGG + Intronic
1161461102 19:4398180-4398202 AGTCCCCAGTAACACCCAGCAGG - Intronic
1162281341 19:9700353-9700375 TGTCTCCAGGACCCCCAAGCAGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1163394071 19:17048865-17048887 TGTCCCCAGTGAGTCCAGGTTGG - Intergenic
1163495976 19:17646865-17646887 TGTCCCCAGTGGCCCCAGGATGG + Intronic
1164270791 19:23669988-23670010 TGTTCCCAGAGACCCCAGTCTGG + Intronic
1164809875 19:31147434-31147456 TGTTCCCACTGGCCCCATGCTGG - Intergenic
1165446298 19:35858576-35858598 TGTCCCCTGGGAGCCCAAGAGGG + Intronic
1165924514 19:39318922-39318944 TGTGTCCAGGGACCCCAGGCGGG + Intergenic
1166051896 19:40265530-40265552 TGTCCCCAGCGACCCCAATCTGG + Intronic
1166818957 19:45564566-45564588 TGTCCCCAGCAACACCAGGCAGG - Intronic
1166975934 19:46605028-46605050 AGTCCCCAGAGTGCCCAAGCTGG + Intronic
1167462483 19:49633122-49633144 TGTCCACACTGACCCCAAATTGG + Intergenic
1167533244 19:50032046-50032068 TGTCCCCAGTGCCCACAATGTGG + Intronic
1168319688 19:55501357-55501379 TGTCACCATTGAGCCCAAGGAGG - Intronic
1168407461 19:56118419-56118441 TGTCCCCCTAGACCCCAACCTGG + Intronic
927495356 2:23548233-23548255 TGTTCACAGGGTCCCCAAGCTGG - Intronic
928364853 2:30692576-30692598 TGTCTCCAGTGACACCCAGAGGG + Intergenic
929366241 2:41159917-41159939 TGTAACAAGTGACCCCAAGTTGG + Intergenic
929539776 2:42810732-42810754 CGTCCCCATTGGCCGCAAGCAGG + Intergenic
930217390 2:48710658-48710680 TGTTCCCAGAGCACCCAAGCTGG - Intronic
932054950 2:68433781-68433803 TGTGCCCTGTGTCCCCAAGACGG - Intergenic
933726049 2:85427904-85427926 TCTCCCCAGTGCCCCCAGCCTGG + Intronic
938320099 2:130356582-130356604 TGTCCCCTGTGACCACAGGAAGG + Intronic
947433040 2:230047158-230047180 TGTGTCCAGAGACCCCAACCTGG + Intronic
947758698 2:232587932-232587954 TGTCCCCTGTGAGCCCAAGAAGG + Intergenic
947825074 2:233100353-233100375 TGTTCCCAGTGACCTCCTGCTGG + Intronic
948505419 2:238424488-238424510 TGTCCCCAGTGACCCCTCTGTGG - Intergenic
1168877494 20:1181451-1181473 TGGGCCCAGTGGCCCCAACCAGG - Exonic
1171410528 20:24943962-24943984 TGTTCCAAGTGGCCCCAGGCAGG - Intergenic
1172025149 20:31943355-31943377 GGTGCCCAGTGACTCCAAGTAGG - Exonic
1173811934 20:45961017-45961039 TTTCCCCAGTGAACTCCAGCTGG - Intronic
1174392217 20:50224659-50224681 TGTCCCCAGTGCCTCAATGCTGG + Intergenic
1174608689 20:51781066-51781088 TTTCCCCAGCTATCCCAAGCAGG + Intergenic
1176148855 20:63578771-63578793 TGTCCCCAGCGTCACGAAGCAGG + Intergenic
1176273184 20:64247085-64247107 TGTCCCCAGTGACTTGAGGCCGG - Intergenic
1179107523 21:38416311-38416333 TGGCCCCAGTGGCCCCAAAAGGG + Intronic
1180127580 21:45802729-45802751 TGTCCCCAAGGACCCCAGGCAGG + Intronic
1181432774 22:22893351-22893373 TGTCCCCAGTGAAGCCAGGCTGG - Intronic
1183538610 22:38417167-38417189 TTACCCCCCTGACCCCAAGCTGG + Intergenic
952505830 3:34006056-34006078 AGTCCACTGTGACCCCAAACAGG + Intergenic
952741240 3:36737219-36737241 TGTCCACCGGGACCTCAAGCCGG - Exonic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
953981407 3:47414980-47415002 TGTCCTCAGGGACCCCAGGGCGG - Exonic
954223959 3:49171174-49171196 TGTCCCCAGTGGCCTCCAGGGGG + Intergenic
954808939 3:53236183-53236205 TGTCCCCTCTGAGCCCAACCAGG - Intronic
955207336 3:56908189-56908211 AGACACCAGTGACCCCGAGCGGG + Intronic
956821970 3:72962088-72962110 GGGCTCCAGTGACCCCAGGCAGG - Intronic
956913039 3:73840978-73841000 TATCCACAGTAGCCCCAAGCTGG + Intergenic
961093818 3:124138033-124138055 GATCCCCAGTGGCCCCCAGCAGG + Intronic
965329334 3:167351488-167351510 AGGTCCCAGTGACCCCAAGCAGG - Intronic
965514837 3:169610003-169610025 TTTCCCAAATGTCCCCAAGCTGG + Intronic
967775688 3:193383665-193383687 AGTTCTCTGTGACCCCAAGCAGG - Intergenic
967941334 3:194768807-194768829 GGTCCACGGTGACCCCAAGGAGG + Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
971099258 4:23444965-23444987 TTTCCCCAGTGCAACCAAGCAGG + Intergenic
974612379 4:64232641-64232663 TGGCCACAGTGACCCCATGTTGG + Intergenic
978476456 4:109136732-109136754 AGGCCTCAGTGACCCCCAGCTGG + Intronic
980337127 4:131490094-131490116 TGTTTCCATTGACCCCATGCAGG + Intergenic
982331595 4:154187154-154187176 TGTGCCCAGTAACACCATGCAGG + Intergenic
983956251 4:173702198-173702220 TGTCCCCAGAGACAGTAAGCAGG - Intergenic
984200498 4:176714539-176714561 TGTCTCCAGTGAAACCAGGCAGG + Intronic
986652742 5:9980401-9980423 TGTCCTCAGTGATCCCATGGAGG - Intergenic
987033223 5:13994854-13994876 TGTTCCCAGTGAACCTAAGCAGG - Intergenic
987970598 5:24939056-24939078 TGTCCCCAGTTGCCCTCAGCTGG - Intergenic
988167777 5:27616748-27616770 TGACCCCAGTGCCTCCAGGCTGG - Intergenic
990568082 5:57050443-57050465 TGTCCGTGGTGAACCCAAGCTGG + Intergenic
994382075 5:99083362-99083384 TGGCCCCTGTGACCCTCAGCTGG + Intergenic
996633570 5:125665240-125665262 TGTCCCCAAAGACCACAAGTTGG + Intergenic
998448608 5:142217461-142217483 TGACCTCAGTGACACCATGCAGG + Intergenic
1000350618 5:160349689-160349711 TGGCCCCCGTGGCCCCAAGGGGG - Exonic
1001010633 5:168094662-168094684 TGTCCCCCATGACCCCCAGATGG - Intronic
1001426467 5:171625824-171625846 TGTCCAAAGTCAGCCCAAGCTGG - Intergenic
1001724574 5:173886354-173886376 TGTCCCCAGTGGCCAGAAGAGGG - Intergenic
1003127568 6:3367802-3367824 TGCACCCAGTGACCCCAACTGGG + Intronic
1005456490 6:26024691-26024713 TGACCACAGTGACCCCAAACTGG - Intergenic
1006187135 6:32187942-32187964 TGGGCCCAGGGACCCCAGGCTGG - Intronic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007738207 6:43994865-43994887 TGTCCTCAGGGACCCCCAGTCGG + Intergenic
1007833449 6:44656115-44656137 TTTCCCCTGTGACCAGAAGCTGG - Intergenic
1008005102 6:46402191-46402213 AGTGCCCAGTGACTCCATGCCGG - Intronic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1016666928 6:146653173-146653195 TGTCTCCAGTCACCCCCAGATGG + Intronic
1019261095 7:82433-82455 TGTCCCCAGTCACCCGGACCTGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020012745 7:4815536-4815558 TGTCCTCAGTGGCCCAGAGCCGG - Intronic
1026130249 7:67614238-67614260 TCTCCCCAGTAACTCCCAGCTGG - Intergenic
1027697829 7:81433346-81433368 TCTCCCCAGAGACCTCAAACAGG + Intergenic
1030107618 7:106000015-106000037 TGGCCCCAGCGCCCCCAGGCTGG - Intronic
1030826785 7:114168815-114168837 TGTCCTCAGGGTCCCCATGCTGG + Intronic
1032601738 7:133304302-133304324 TGACCACAGTGTCCCCAAGGAGG - Intronic
1032793798 7:135261518-135261540 TGTCCCCAGGCAGCCAAAGCAGG - Intergenic
1035036983 7:155901930-155901952 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037000 7:155902007-155902029 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037017 7:155902084-155902106 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035592208 8:824651-824673 TGACCCCAGTGAACCCAAACAGG - Intergenic
1035770899 8:2146158-2146180 TGTCCCCAGTAACATAAAGCTGG + Intronic
1036688572 8:10927346-10927368 TGCCCCCTGTGACCCAAACCCGG + Intronic
1041296043 8:56358565-56358587 TGTCCCTGCTGGCCCCAAGCTGG - Intergenic
1047220835 8:122917022-122917044 TGTCCCCAGTCCCCCCCACCAGG + Intronic
1047790523 8:128199011-128199033 CTTTGCCAGTGACCCCAAGCAGG + Intergenic
1048277460 8:133077660-133077682 TGTTTTCAGTAACCCCAAGCGGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049623183 8:143608249-143608271 TGGCCCCAGGAACCCAAAGCGGG + Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1055574349 9:77647316-77647338 GGTCACCACAGACCCCAAGCTGG + Intronic
1056766042 9:89445355-89445377 TCTCACCAGTGACCACAAACTGG + Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059779025 9:117507539-117507561 TGTCCCTGGTTCCCCCAAGCTGG - Intergenic
1060524692 9:124313860-124313882 TGTGTCCAGTGACCCAAAGGAGG - Intronic
1185701417 X:2233505-2233527 TCTCCCCAGCGCCCCCCAGCCGG - Intronic
1186592343 X:10944259-10944281 TGTCTCCTGTCACCCCCAGCTGG - Intergenic
1186998330 X:15148526-15148548 TGTCCCCAGTGTCCCCATCTTGG + Intergenic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1189613851 X:42764895-42764917 TGTCCCCAAAGACCACAAGTTGG - Intergenic
1190072610 X:47291515-47291537 TGTCCCCAAAGACCACAAGTTGG + Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1191093139 X:56645763-56645785 TCCCCCCACTGACCCCCAGCAGG + Intergenic
1192573362 X:72223914-72223936 TGTCCCCAAAGACCACAAGTTGG - Intronic
1192919333 X:75689951-75689973 TGTGCTCAGTAACCCCATGCAGG - Intergenic
1194920895 X:99762075-99762097 TGTCCTCAGTCACCAAAAGCTGG - Intergenic
1197730587 X:129806031-129806053 TGAGACCAGTGACCCCAAGCAGG + Exonic
1197767112 X:130066567-130066589 TGGCCACAGTGACACCAGGCAGG + Exonic
1200085378 X:153601702-153601724 TGTCCCCAGTGTCCCAAAGGTGG + Intergenic