ID: 1162328893

View in Genome Browser
Species Human (GRCh38)
Location 19:10014860-10014882
Sequence ACTAAGGTGCAGACTGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162328891_1162328893 -3 Left 1162328891 19:10014840-10014862 CCTATTTTAGAAATGAGGAAACT 0: 6
1: 187
2: 1672
3: 6104
4: 13256
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138
1162328888_1162328893 2 Left 1162328888 19:10014835-10014857 CCTGCCCTATTTTAGAAATGAGG No data
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138
1162328890_1162328893 -2 Left 1162328890 19:10014839-10014861 CCCTATTTTAGAAATGAGGAAAC 0: 3
1: 53
2: 521
3: 2718
4: 8083
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138
1162328887_1162328893 7 Left 1162328887 19:10014830-10014852 CCTGGCCTGCCCTATTTTAGAAA 0: 1
1: 1
2: 3
3: 31
4: 356
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138
1162328886_1162328893 12 Left 1162328886 19:10014825-10014847 CCGTGCCTGGCCTGCCCTATTTT 0: 1
1: 0
2: 41
3: 399
4: 2235
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138
1162328885_1162328893 15 Left 1162328885 19:10014822-10014844 CCACCGTGCCTGGCCTGCCCTAT No data
Right 1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG 0: 1
1: 0
2: 2
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162328893 Original CRISPR ACTAAGGTGCAGACTGTGAA AGG Intronic
900162360 1:1230108-1230130 CCGGAGGGGCAGACTGTGAAAGG - Intronic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
907968005 1:59352226-59352248 AACAAGGTGCAGACTGAGGAAGG + Intronic
908481489 1:64544544-64544566 ACTAAGGTGCAGCCAGTACAAGG + Intronic
915979066 1:160408876-160408898 ACTAAGGTACAGAGTGGGCAAGG - Intronic
916606698 1:166349993-166350015 ACTAAGGTGTGGAAGGTGAAGGG + Intergenic
919057787 1:192592222-192592244 ACTGTGGTGCATACTGTCAAGGG - Intergenic
921006883 1:211102396-211102418 ACGAAGGGAAAGACTGTGAAGGG - Intronic
922605729 1:226888799-226888821 ACCAAGGTGGAGCCTGTGACTGG - Intronic
923806924 1:237267692-237267714 GCTAAGGTGCAGATTCTGATTGG - Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068584126 10:58777491-58777513 ACCAAGGTGGAGCCTGTGAATGG - Intronic
1068611408 10:59064414-59064436 AATAAGGTGCTTTCTGTGAAAGG + Intergenic
1069517917 10:69094168-69094190 AGTAAGGGGCAGACATTGAAAGG + Intronic
1070322092 10:75362167-75362189 ATTAAGGTGCAAAATGTTAATGG - Intergenic
1071478605 10:86045812-86045834 ACTAAGGTTCACATTGGGAAAGG + Intronic
1071879253 10:89877009-89877031 ACAAAGATGCAGCCAGTGAATGG - Intergenic
1072555175 10:96509364-96509386 AGCAAGGAGCAGACAGTGAAGGG + Intronic
1078101110 11:8330837-8330859 ACTATGATGGAGACTGAGAAAGG - Intergenic
1079471318 11:20780861-20780883 ACCAAGGAGAAGAGTGTGAATGG + Intronic
1079873531 11:25829703-25829725 CTGAAGGTGCAGACTGTAAAGGG - Intergenic
1083751290 11:64762229-64762251 GCTGGGGTGCAAACTGTGAAAGG - Intergenic
1084652210 11:70495859-70495881 ACACAGGTGCAGACAGGGAAGGG + Intronic
1089270262 11:117297038-117297060 TCTAAGGGGCAGACTGTGGCTGG - Intronic
1090042168 11:123300753-123300775 ATTATGGTGCAGGCTGTGATGGG - Intergenic
1090393595 11:126405333-126405355 AGTAAGGTGAGGACTGTGCATGG - Intronic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1093893942 12:24556052-24556074 ACTATAGTGCAGCCTATGAAAGG - Intergenic
1097969941 12:65622872-65622894 ACTAAGGTGGGGACAGTGACAGG + Intergenic
1098818808 12:75205051-75205073 ACTAGGGTCCTAACTGTGAAAGG - Intronic
1101406850 12:104436370-104436392 ACCAAGGGGCAGACAGTAAAAGG + Intergenic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1105049370 12:133035034-133035056 TCCAGGGTGCACACTGTGAAGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108301489 13:49081881-49081903 ACAAAGTTGCAGACTGGCAACGG - Intronic
1115372723 14:32636797-32636819 AGAGAGGAGCAGACTGTGAACGG + Intronic
1115920814 14:38371381-38371403 ACTAAGATGAAGAATGAGAATGG + Intergenic
1117233824 14:53750745-53750767 ACTAAGAAGCATTCTGTGAATGG + Intergenic
1117738015 14:58787378-58787400 ACTAATGTGAAGAATGAGAAAGG - Intergenic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1120483488 14:85082229-85082251 GCTAATGTGCAGACAGGGAAAGG + Intergenic
1120587775 14:86335935-86335957 ACCATGGTGCAGATTGTAAAGGG - Intergenic
1124199752 15:27668863-27668885 ACTGAGGTGAGGACTATGAATGG - Intergenic
1127624455 15:60766655-60766677 AAAAAAGTGCAGTCTGTGAAGGG - Intronic
1128546198 15:68569846-68569868 ACCGAGGTGCAGAGAGTGAAAGG + Intergenic
1128693755 15:69744951-69744973 GCTGAGGAGGAGACTGTGAAGGG - Intergenic
1129250558 15:74306611-74306633 ACTGAGGTCCAGACAGGGAAGGG - Intronic
1129703928 15:77783885-77783907 ACTGAGGTGCAAACGGAGAAAGG - Intronic
1133777340 16:8907348-8907370 ACCACGGTAAAGACTGTGAATGG + Intronic
1134374987 16:13663807-13663829 ACAAAGAAGCAGAATGTGAAAGG - Intergenic
1137662205 16:50218045-50218067 AGTAAGGTGCAGGCTGAGCATGG - Intronic
1138643530 16:58405567-58405589 ACTTGGGTGCTGACTATGAAGGG + Intronic
1139651268 16:68363432-68363454 ACTAAGGTGGAGACAGGGACTGG - Intronic
1146293379 17:31629416-31629438 AGTAAGGTACAGATTGTGGACGG + Intergenic
1146595461 17:34164612-34164634 ACTGAGGTTCAGAGAGTGAAAGG + Intronic
1148566827 17:48637828-48637850 ACTATGGGGCAGACTATGATGGG + Intergenic
1149041109 17:52189360-52189382 ACTGAGTTGCACACTTTGAAAGG - Intergenic
1151144775 17:72030648-72030670 ACTATGGGGCAACCTGTGAAGGG - Intergenic
1152386983 17:79980567-79980589 ACTGTGGTGCAGACAGTGTAGGG + Intronic
1156466776 18:37352851-37352873 ACCAAGGTGCAGAGTGGGACGGG + Intronic
1157392169 18:47311967-47311989 ACACAGGTGCAGACTGTGAAAGG - Intergenic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
1163813343 19:19448244-19448266 ACAAAGGTGCCGCCTGTGAAGGG - Intronic
1165926435 19:39328983-39329005 ACAAAGGTTCAGACTGGGATGGG - Exonic
1166003781 19:39893622-39893644 ACTAGGGAGCAGACAGAGAAAGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
929880610 2:45833951-45833973 ACTAATGTGGAGAGTGTGTAAGG - Intronic
933987540 2:87604336-87604358 ACTAAGGCCCAGCCTGAGAATGG - Intergenic
935942373 2:108254181-108254203 AGCAGGGTGCAGACTGTCAAGGG - Intronic
936086617 2:109473798-109473820 GCTAAGGTGCTGGCTGTGCACGG - Intronic
936306299 2:111346472-111346494 ACTAAGGCCCAGCCTGAGAATGG + Intergenic
943446241 2:187991705-187991727 ACTAAGGGGCAGACAAGGAAGGG + Intergenic
945017770 2:205537446-205537468 ACAAAGGTACAGAGTCTGAAGGG - Intronic
945125364 2:206503613-206503635 ATTGAGGTGCAGTATGTGAAGGG + Intronic
1172834250 20:37862790-37862812 ACTAAGGAGCTGGCTATGAAGGG - Intronic
1173649739 20:44655583-44655605 ACTAAGGTGCAGAGGCTGGAGGG - Intergenic
1173956914 20:47040411-47040433 ACTGAGGCTCAGACTGTGGAAGG - Intronic
1174077201 20:47946115-47946137 ACTAAGGGCCAGATTGTGCAGGG + Intergenic
1174900676 20:54496286-54496308 ACAAAGGTGTAGGCTGAGAAAGG + Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1178380183 21:32101007-32101029 TCCAGGGTGCAGACTCTGAATGG - Intergenic
1179793206 21:43767660-43767682 ACTGAGGCACAGACTGTGCATGG - Intergenic
1181925981 22:26359011-26359033 GCTAAGGTCCAGACTGTTTATGG + Intronic
950143096 3:10628630-10628652 ACTATGGTAAAGGCTGTGAAAGG - Intronic
950212805 3:11136386-11136408 ACTGAGGTGCAGGCTGTGTGTGG - Intergenic
950967987 3:17159666-17159688 CCTAAGGTGCTGACTGACAAGGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951970366 3:28438190-28438212 ACAAAGGTACAGACAATGAAAGG + Intronic
952194962 3:31065675-31065697 ACTGAGGTGCAGCCTGGGCATGG + Intergenic
954504188 3:51052747-51052769 ACTAATGTGAAAGCTGTGAAGGG + Intronic
956070331 3:65442761-65442783 ACTAATGTGTGGATTGTGAATGG + Intronic
959869086 3:111306115-111306137 ACTAAGTTGCAAAATGTCAAAGG + Intronic
961498927 3:127316702-127316724 GCTAAGGTGCAGATTCTGAGGGG + Intergenic
961760026 3:129160559-129160581 ATTATGGAGCAGACTGAGAACGG + Intronic
963350175 3:144141820-144141842 CCAAAGGTGCAGACTATGTAAGG + Intergenic
963822710 3:149915888-149915910 AATAAGATGAAGGCTGTGAATGG + Intronic
965453123 3:168862804-168862826 ACTATGGTACACACTGTGTATGG + Intergenic
971385785 4:26139502-26139524 ACTGAGCTGCAGGCTGTGACTGG - Intergenic
978535215 4:109755042-109755064 ACTAATTTGTAGACTGTAAAAGG + Intronic
978567094 4:110094662-110094684 ACTAAGGGCCAGGCTGTGTAGGG + Intronic
979236994 4:118412208-118412230 AATAATCTGCAAACTGTGAAAGG + Intergenic
980183381 4:129430325-129430347 AATAAGGTGGATACTGAGAACGG + Intergenic
981115227 4:140982248-140982270 AATAAGGTGGTGACTTTGAAGGG - Intronic
982217614 4:153095686-153095708 ACTAAGGTCCAGACTGTAATAGG + Intergenic
982367513 4:154596005-154596027 ACCAAGCTGCTTACTGTGAAAGG + Intergenic
984208650 4:176818123-176818145 ACTAAGGTGCTGACTATGAATGG - Intergenic
984483016 4:180330219-180330241 ACTATGGAGCAGAATGGGAAGGG - Intergenic
989090544 5:37725743-37725765 ACTAAGGTGCATAGTTAGAAGGG - Intronic
992563122 5:77972399-77972421 ACTAATGTGCAGGATGAGAACGG - Intergenic
994250873 5:97535599-97535621 TCTGAGGTGCATACTTTGAAAGG + Intergenic
999021905 5:148175225-148175247 ACTAAGATCCAGAGTGTAAAGGG - Intronic
999200263 5:149811398-149811420 ACTAAGTTGAAGGCTGTGGAAGG - Intronic
999315933 5:150583997-150584019 ACTCACGTGGGGACTGTGAAAGG + Intergenic
999624134 5:153502267-153502289 ACTGTGGTGGAGACTGTGATGGG - Intronic
1000774487 5:165401770-165401792 ACGAACATTCAGACTGTGAAGGG + Intergenic
1006563755 6:34936289-34936311 ACTGAGGTAGAGACTCTGAAGGG + Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1020604703 7:10322052-10322074 ACTAAGGTTTAGACTCTGACTGG + Intergenic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1022001672 7:26231988-26232010 ACCAAGATGCAGCCTGTGAATGG + Intergenic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1024062805 7:45711242-45711264 ACTAAGATGGAGATTGTGAGGGG + Intronic
1028895730 7:96039715-96039737 ACTGAGGTGCAGGCAGTGAAGGG - Intronic
1031168383 7:118259827-118259849 AATAAGCTCCAAACTGTGAAAGG - Intergenic
1031895633 7:127345657-127345679 AGTAAGGGTCAGACTGTGCAAGG + Intergenic
1032271314 7:130409913-130409935 GCTGAGGAGCAGCCTGTGAAAGG - Intronic
1033947659 7:146741603-146741625 TTTATGGTGAAGACTGTGAAGGG + Intronic
1038913209 8:31990533-31990555 ACTAAGGTGCAAAGAGTCAATGG + Intronic
1039838522 8:41277177-41277199 GCTAAGCTGCACACTGGGAAGGG - Intronic
1043328341 8:79081440-79081462 ACTAAGATGCAGATTTTCAAAGG + Intergenic
1043344683 8:79285965-79285987 CCTAAACTGCAGCCTGTGAAGGG + Intergenic
1046349183 8:112983842-112983864 ATTATGGTGTTGACTGTGAAAGG + Intronic
1046542635 8:115605894-115605916 ATTGAGGTGCACACTGAGAATGG - Intronic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1051156653 9:14155383-14155405 ACTAACGTGCAGAGTGTAGAGGG - Intronic
1056872906 9:90301730-90301752 ACTAAGGCTCAGATTTTGAAGGG - Intergenic
1060215309 9:121735429-121735451 ACTAAGCTGCAGACTGTGTCAGG - Intronic
1060475097 9:123980892-123980914 GCCTGGGTGCAGACTGTGAAGGG + Intergenic
1061251203 9:129427528-129427550 ACGATGGTGAAGGCTGTGAAAGG + Intergenic
1186539573 X:10386756-10386778 GATAAGGGGCAGACTGTGAATGG + Intergenic
1186837435 X:13451649-13451671 ACTAAGGAGAGGAGTGTGAAGGG + Intergenic
1187358787 X:18604670-18604692 CGTGAGGTGCAGACAGTGAATGG - Exonic
1188285924 X:28325335-28325357 ACTAAGGTAAAGAATATGAAAGG - Intergenic
1193367191 X:80649325-80649347 ACTAAGTTGTATACTTTGAATGG - Intergenic
1199193745 X:145002933-145002955 AAAAATGTGCTGACTGTGAATGG + Intergenic