ID: 1162329218

View in Genome Browser
Species Human (GRCh38)
Location 19:10017129-10017151
Sequence GTCCAGCTGGGCCACGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162329218_1162329228 24 Left 1162329218 19:10017129-10017151 CCCTCACCGTGGCCCAGCTGGAC 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1162329228 19:10017176-10017198 CAGTGTCTCAGCTGTATCCAGGG 0: 1
1: 0
2: 5
3: 21
4: 207
1162329218_1162329223 -4 Left 1162329218 19:10017129-10017151 CCCTCACCGTGGCCCAGCTGGAC 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1162329223 19:10017148-10017170 GGACGTGTGCAGTGATGAGTCGG 0: 1
1: 0
2: 0
3: 12
4: 97
1162329218_1162329224 -1 Left 1162329218 19:10017129-10017151 CCCTCACCGTGGCCCAGCTGGAC 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1162329224 19:10017151-10017173 CGTGTGCAGTGATGAGTCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 67
1162329218_1162329227 23 Left 1162329218 19:10017129-10017151 CCCTCACCGTGGCCCAGCTGGAC 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1162329227 19:10017175-10017197 CCAGTGTCTCAGCTGTATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162329218 Original CRISPR GTCCAGCTGGGCCACGGTGA GGG (reversed) Exonic
901254216 1:7807330-7807352 GTGCAGCTGTTCCACTGTGATGG + Intronic
901259687 1:7862257-7862279 GCCCAGCAGGCCCACTGTGAGGG - Intergenic
902391995 1:16112317-16112339 GTCCACCTGGGGCAGGGTTAGGG - Intergenic
902570157 1:17342087-17342109 GTCCAGCAGGGAGATGGTGAGGG - Exonic
902802744 1:18840400-18840422 GGCCAGCAGGGCCACAGCGATGG + Exonic
903846434 1:26282199-26282221 GACCAGCTGGGCCAGGGAGGGGG - Intronic
906382379 1:45340991-45341013 ACCAAGCTAGGCCACGGTGATGG - Intronic
908654969 1:66378837-66378859 GTCCAGATTGGCCTAGGTGATGG - Intergenic
914859446 1:151374041-151374063 GTGCAGCTGCCCCACGGGGAAGG + Intergenic
916745779 1:167683943-167683965 GGCCAGCTGGGCCACCGAGGGGG - Exonic
916819019 1:168379982-168380004 GTCCAGCTGAGGTACCGTGAGGG - Intergenic
917473797 1:175350826-175350848 GTCCACTTGGGACAAGGTGAGGG + Intronic
918311317 1:183287606-183287628 ATCCCACTGGGCCAAGGTGATGG + Intronic
919724517 1:200873183-200873205 GCCCAGCAGGCCCACGGCGAAGG - Exonic
919923576 1:202180457-202180479 CTCCAGCTGGGCCCTGGAGATGG + Intergenic
921048145 1:211491706-211491728 GTGCAGCTGTGCCAGGGTGCGGG + Intronic
922749150 1:228062644-228062666 GTCCTGCTGGGCAGCCGTGAGGG - Intergenic
1063577030 10:7271554-7271576 GTTCATCTGGGCCAGGGTCAGGG + Intronic
1063580684 10:7304031-7304053 GGCGAGGTGGGCCACGGAGATGG + Intronic
1070788963 10:79178497-79178519 GCCCAGCTGGGCGGGGGTGAAGG + Intronic
1071531649 10:86394040-86394062 GTGCCGCTGGGGCACGGGGAGGG - Intergenic
1072795486 10:98351662-98351684 CTCCAGCAGAGCCAGGGTGAAGG - Intergenic
1073479097 10:103774915-103774937 GTCCAGCTGGGACACCGGAAGGG - Intronic
1074244032 10:111669705-111669727 GTCCAGCTGCTTCAGGGTGATGG + Intergenic
1075572357 10:123555625-123555647 GTCCACCTGGCCCACGGTTGGGG - Intergenic
1075765109 10:124886949-124886971 GTCCAGCTGGCTTAGGGTGAAGG - Intergenic
1077382277 11:2249752-2249774 GTCCAGCAGGGACCCGCTGAAGG - Intergenic
1077410172 11:2400169-2400191 TGACCGCTGGGCCACGGTGAAGG - Intergenic
1079548468 11:21664709-21664731 GCCCAGTTGGGACACTGTGAGGG + Intergenic
1082804424 11:57438517-57438539 GTCCAGCTGCTCCACGGTTGAGG - Intergenic
1083782618 11:64925977-64925999 GACCAGCAGGGCCATGGGGAGGG + Intronic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1084117083 11:67048825-67048847 CTCCAGCTGGGCTATGGAGAGGG - Exonic
1084562456 11:69912406-69912428 GGCCAGCTGGGCCAAGGCCAGGG - Intergenic
1088643385 11:111895670-111895692 GTACAGTTGGGCCAGGGTGGTGG - Intergenic
1091205357 11:133817334-133817356 GTCCAGCTGAGCTAAGGTCAAGG - Intergenic
1091896561 12:4109841-4109863 GGCCAGCTGGGCAAAGGTGAGGG + Intergenic
1092236679 12:6814888-6814910 CTCCAGCTGAGACACGGAGAGGG - Exonic
1096473918 12:51896470-51896492 GTCCAGACGGGCCAGGGTAAGGG - Intergenic
1100613146 12:96208858-96208880 GTGCAGCTGGGCCAGGGAAAGGG + Intronic
1101252548 12:102950426-102950448 GTCCAGGTTTGCCACGGTGGTGG + Intronic
1102222644 12:111204922-111204944 TATCAGCTGGGCCAGGGTGATGG - Intronic
1102347301 12:112168296-112168318 GTCCCTCTGGGCCAGGCTGAGGG + Intronic
1102985333 12:117273103-117273125 GACCAGCTGGGCCTCAGGGAAGG - Intronic
1103004247 12:117408746-117408768 GGACAGCTGGGCCCAGGTGACGG - Intronic
1103564409 12:121808265-121808287 GTCCAGCTCGCCCACTGGGAGGG - Exonic
1103916840 12:124380194-124380216 CTCCAGCCTGGCCACGGTGAAGG - Intronic
1104793417 12:131498799-131498821 TTCCATTTGGGCCACAGTGATGG - Intergenic
1105263064 13:18794057-18794079 CAGCAGCTGGGCCACGGTGCTGG + Intergenic
1106101173 13:26696001-26696023 GTCCAGCTGGGCGACAGGGAGGG - Intergenic
1114530110 14:23390171-23390193 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1114535540 14:23419959-23419981 GCCCAGCTCGGCCACGCTGTCGG + Exonic
1117334903 14:54748896-54748918 CTCCAGCTGGCACTCGGTGAGGG - Exonic
1117985455 14:61382015-61382037 TTCCATCTGTGCAACGGTGATGG + Intronic
1120054835 14:79911452-79911474 GACCAGCTGTGCTACTGTGATGG + Intergenic
1121452828 14:94020292-94020314 GTCCAGGTGGGGCACAGAGATGG - Intergenic
1124516029 15:30368022-30368044 TTCCACCTGGGCCCAGGTGAGGG + Intronic
1124726891 15:32162709-32162731 TTCCACCTGGGCCCAGGTGAGGG - Intronic
1128055529 15:64696815-64696837 GTACAGCTGGGCAATGATGATGG + Intronic
1128747390 15:70124085-70124107 CCCCAGCTGGACCACTGTGAGGG + Intergenic
1129249567 15:74301396-74301418 GTCCAGCTGGGGCAGGGACATGG + Intronic
1129273117 15:74429703-74429725 GTCCAGATGGGCATAGGTGAGGG - Intronic
1130694585 15:86118134-86118156 GTCCACCTGGGAAAAGGTGAGGG - Intergenic
1132739007 16:1401648-1401670 GGCCAGCTGGGCGGCGGGGAAGG - Exonic
1132897137 16:2234437-2234459 GTGCACCTGGGCCACGGCCAGGG - Intronic
1133802080 16:9092244-9092266 GTAGAGCTGGGCCACGGCGGTGG - Exonic
1138389690 16:56661421-56661443 GTGCAGATGAGCCACGGTGGAGG + Intronic
1138512221 16:57515324-57515346 GTCCAGGTGGGCCCCGGGCAGGG - Exonic
1140674820 16:77317529-77317551 GACCAGCTGGGCCAACGTGGCGG - Intronic
1141967155 16:87453231-87453253 GGCCCGCTGGGCCACAGTCATGG + Intronic
1142080707 16:88147300-88147322 GTCTCCCTGGGCTACGGTGAGGG - Intergenic
1142093190 16:88226047-88226069 CACCAGCGGGGCCACTGTGACGG - Intergenic
1142518820 17:491239-491261 GTCCCGCTGGGACAGGGCGAGGG - Intergenic
1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG + Intergenic
1145112293 17:20174562-20174584 CTCCATTTGGGACACGGTGAAGG - Intronic
1147418850 17:40312081-40312103 CTCCAGTTGGGCCAGGATGAAGG + Intronic
1150494490 17:65596872-65596894 GTCTAGCTGGGCAACGTTGAAGG + Intronic
1151455950 17:74225907-74225929 CTCCAGCTGGGCCTCCCTGATGG - Intronic
1151472839 17:74328444-74328466 CTCCAGCTCTGCCACGCTGATGG - Exonic
1152234454 17:79131383-79131405 GTTCAGCTGGAAGACGGTGAAGG - Intronic
1152662129 17:81547363-81547385 GCCGAGCTGGTCCACGGGGATGG + Exonic
1153061196 18:996921-996943 GTCTAGCTGGGACAAGGTGGGGG - Intergenic
1153748016 18:8200273-8200295 GTCCACCTGGGTCTCGGTGGGGG - Intronic
1157318058 18:46610126-46610148 GTTCTGGTGGGCCACGGTCAGGG + Intronic
1157426488 18:47588789-47588811 CCCCAGCTTGGCCACAGTGATGG - Intergenic
1157725059 18:49957910-49957932 GGCCAGCTGGGCTTCTGTGATGG - Intronic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1160578149 18:79868626-79868648 GTCCAGCTGGGGGCTGGTGAAGG + Intronic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161425417 19:4200176-4200198 TGCCAGCTGGGCCCCGGGGAGGG + Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165229456 19:34377826-34377848 GTTCAGCTGGGCCAGGGTTTTGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
1167072254 19:47228033-47228055 GCCCAGCCGGGCCACTGGGAGGG - Intronic
1167466309 19:49652500-49652522 GTCAAGCCGGCCCACCGTGATGG - Exonic
927566658 2:24119400-24119422 GTGCAGCTGAGCCATGGGGAAGG - Intronic
928444542 2:31321229-31321251 GACCAGGTGGACCACGGTGGTGG - Intergenic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
933652414 2:84860045-84860067 GTCCAGCTGTGCCAAGTTCATGG - Intronic
934725664 2:96616770-96616792 ATGCTGCTGGGCCACGGTGTGGG - Intronic
935903456 2:107817502-107817524 GCCCAGCTGAGCCACGGTTGGGG + Intergenic
944875581 2:203961375-203961397 GGCCAGGTGGGCCACCATGAAGG - Exonic
948456654 2:238107605-238107627 GTCCTGCTGCCCCAGGGTGACGG + Intronic
1168763015 20:362583-362605 GGCCAGCAGGGCCCCTGTGATGG + Intergenic
1172032416 20:31991252-31991274 GACCAGCTGGTCCAATGTGAAGG - Intronic
1173546092 20:43899482-43899504 GTCCAGGTGGGCCACCAGGATGG - Intergenic
1173841400 20:46159539-46159561 GTCCAGCTGGGGCACAGGGAGGG + Intergenic
1174182064 20:48681196-48681218 GCCCAGCTGGGCCAAGGGGTGGG - Intronic
1174292657 20:49519888-49519910 GTGCTGCTGGGCCAGGGTCAGGG - Intronic
1175391623 20:58631318-58631340 GGTCATCTGGGCCACTGTGAAGG - Intergenic
1176170100 20:63692893-63692915 GTCCTGCAGGGCCTGGGTGAAGG - Exonic
1176838761 21:13820271-13820293 GTCGAGCTGGGGGACGGTCAGGG - Intergenic
1178960003 21:37056841-37056863 GTCCAGCTGAGCTGGGGTGATGG + Intergenic
1179476363 21:41648732-41648754 GACCAGCTGGGCCCCGGGGGAGG + Intergenic
1179875801 21:44266802-44266824 GTCCAGCTGGGCCCAGGCCAAGG - Intergenic
1180793725 22:18591818-18591840 GCCCTGCTGGGCCCTGGTGATGG - Intergenic
1181228015 22:21403502-21403524 GCCCTGCTGGGCCCTGGTGATGG + Intergenic
1181250638 22:21531337-21531359 GCCCTGCTGGGCCCTGGTGATGG - Intergenic
1183011120 22:34947433-34947455 GTGTAGCTGGGCCACAGTGAGGG + Intergenic
1183467379 22:37986521-37986543 GTCCAGCTGTGCCAGGATGGGGG + Intronic
1184667996 22:45998560-45998582 GCACAGCTGGGCCCTGGTGAGGG - Intergenic
1184970828 22:48018798-48018820 GTCCAGCTGGGAGAGGATGATGG + Intergenic
1185156445 22:49196034-49196056 GTCAGGCTGGGCCATGCTGATGG + Intergenic
953637666 3:44676570-44676592 CTCCAGGTGGGCCCCAGTGAGGG + Intergenic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
954685272 3:52366836-52366858 GTACAGCTGGCCCATCGTGATGG - Exonic
967967270 3:194971916-194971938 GTCCAGCTGGGCCACGAAACTGG - Intergenic
968928674 4:3563881-3563903 TTGCAGCTGTGCCATGGTGAGGG + Intergenic
968928700 4:3564115-3564137 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928718 4:3564271-3564293 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928735 4:3564427-3564449 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928773 4:3564739-3564761 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928800 4:3564973-3564995 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928810 4:3565047-3565069 TTGCAGCTGTGCCATGGTGACGG + Intergenic
968928846 4:3565359-3565381 TTGCAGCTGTGCCATGGTGAAGG + Intergenic
969318293 4:6395243-6395265 GTCCAGGCTGGCCACGGGGAAGG - Intronic
970572784 4:17399055-17399077 GTCCAGCAGGGCCTCTGTGAAGG + Intergenic
974192926 4:58531744-58531766 GTTCTGCTTGGCCACAGTGAAGG + Intergenic
977055849 4:92189439-92189461 TTCCAGCTGGGCACTGGTGAGGG + Intergenic
977172590 4:93781371-93781393 GACCTGCTGGGCTGCGGTGAGGG + Intergenic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
978761452 4:112358828-112358850 GTCCTGCAGGGCCTGGGTGAAGG - Intronic
985432296 4:189893062-189893084 GCCCAGCTGGGGGACGGTGGGGG + Intergenic
988491945 5:31712419-31712441 GTTCAGCTGGGGCACTGGGATGG + Intronic
992800135 5:80288517-80288539 GACCAGCTGGGCCACGTAGCTGG - Intergenic
999065756 5:148683896-148683918 GTCCAGTGGGGCCTCAGTGAGGG - Intergenic
1001145499 5:169180526-169180548 GGACTGCTGGTCCACGGTGATGG + Intronic
1002932399 6:1643634-1643656 GACCACCTGGGCCACGGTGGGGG + Intronic
1003192566 6:3887471-3887493 GGGAACCTGGGCCACGGTGAGGG - Intergenic
1004505972 6:16246900-16246922 GTCCATGTTGGCCACGATGATGG - Exonic
1006010270 6:31037234-31037256 GTCCAGCTTGGCCTTGGTGAGGG + Intergenic
1006022270 6:31124257-31124279 GGCCAGCTGGGGCAAGTTGAGGG + Intronic
1013304925 6:108838954-108838976 GTCCATCTGGGTCACGGAGTGGG - Intergenic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1019363196 7:616448-616470 GACCAGCTGGGAAACAGTGATGG + Intronic
1019710001 7:2513844-2513866 GGCCAGCTGGGCCATGGGGCTGG - Intronic
1024063417 7:45715185-45715207 GTCCAGGAGGGCCACTGGGAAGG + Exonic
1028223097 7:88219746-88219768 GCCCTGCGGGGCCAAGGTGAGGG - Intronic
1032511470 7:132475833-132475855 GTCCATCTGGGCAATGGTCAGGG + Intronic
1033227500 7:139573161-139573183 CACCAGGTGGGCCACGGTGCCGG + Exonic
1033641700 7:143268104-143268126 ATCCACATGGGCCACGGTGATGG - Exonic
1033778492 7:144641361-144641383 CTCCAGCTGGGGAACTGTGAAGG + Intronic
1034348957 7:150404369-150404391 CACAAGCTGGGCCACGGTGCTGG + Intronic
1034778817 7:153858331-153858353 GTTCTGCTGGGGCAGGGTGAAGG + Intergenic
1035016829 7:155774058-155774080 ATCTGGCTGGGCCATGGTGAGGG - Intronic
1035225087 7:157428343-157428365 GCCCAGCGGGGCTACGGTGCTGG + Intergenic
1035557779 8:579387-579409 GCCCAGCTGGGCACAGGTGATGG + Intergenic
1035621948 8:1041854-1041876 GTCCAGCTGACCCACGGCAAAGG - Intergenic
1038179761 8:25215164-25215186 GTCCAGCTGAGCCATTGTTAGGG - Intronic
1039707629 8:40023471-40023493 TTCCAGCTGGGGCACGGGGAGGG + Intergenic
1039984962 8:42439369-42439391 GACCAGCTGGGCCTGGGTGTGGG - Intronic
1040016761 8:42706490-42706512 CTCCACCGGGGCCACGCTGAGGG - Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048213252 8:132474819-132474841 GGGAAGCTGGGCCAAGGTGAAGG + Intronic
1048252578 8:132878898-132878920 GTCCAGCTGGCCCAAGGCTAGGG + Intronic
1048786160 8:138052665-138052687 GACCAGCTTGGCCAACGTGATGG - Intergenic
1048980264 8:139699628-139699650 GTCCAGCTGGGCCCCGCAAAGGG - Intronic
1049218056 8:141416793-141416815 GCACAGCTGGGCCAGGCTGATGG + Intronic
1049682830 8:143927324-143927346 CTCCAGCAGGGCCTGGGTGATGG + Exonic
1052861862 9:33442414-33442436 GACCACCAGGCCCACGGTGAAGG + Exonic
1057493870 9:95544417-95544439 GTCCAGGTGGGAAACAGTGAGGG - Intergenic
1058809789 9:108628370-108628392 CTGCAGCTGGGCCAAGGTCAAGG + Intergenic
1060228421 9:121809913-121809935 GTCGAGCTGAACCCCGGTGACGG + Intergenic
1060235577 9:121860341-121860363 GTCCCGCTGGTCCAGGGTCATGG + Exonic
1061867245 9:133499195-133499217 GTCCAGCAGGGGCAGGGTGCTGG - Intergenic
1062085806 9:134647604-134647626 GTCCAGCTGGGGCCGGGTCACGG - Intronic
1062395334 9:136350482-136350504 CTCCAGCTGGGCCAAGGTACTGG + Intronic
1062453993 9:136627191-136627213 GCCCAGCTGGAGCACGGGGAGGG + Intergenic
1190247389 X:48699654-48699676 GTCCAGGTGAGCCAGGGTGGTGG + Intronic
1194981819 X:100449429-100449451 GTGGAGCTGGGCCAAGATGATGG + Intergenic