ID: 1162329457

View in Genome Browser
Species Human (GRCh38)
Location 19:10018674-10018696
Sequence AAGTAATGCTAGAAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162329452_1162329457 22 Left 1162329452 19:10018629-10018651 CCTTGGACTTGGAGTACGGGGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162329457 Original CRISPR AAGTAATGCTAGAAGAGTGA GGG Intronic
901906684 1:12418372-12418394 AGCTAAAGCAAGAAGAGTGAGGG - Intronic
904820548 1:33240755-33240777 AAGCAGTGATAGCAGAGTGATGG + Intergenic
904850881 1:33458733-33458755 AGTTAATGCTACAAGACTGATGG - Intergenic
904926508 1:34053161-34053183 AAGTAATGAGAGATGATTGATGG - Intronic
905087861 1:35399612-35399634 AAATAATGCTTGTAGAATGAAGG - Intronic
905319394 1:37105186-37105208 AAGTCATGCTGGCAGAGTCAGGG + Intergenic
906220404 1:44073826-44073848 AAGTAAAGCAAAGAGAGTGATGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907713460 1:56906062-56906084 AAGTCTTGCTAGAAGATGGATGG - Intronic
908235502 1:62143903-62143925 AAGGAAAGCCAGAAGAGTGTGGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909167778 1:72250336-72250358 CAGTAATGCTAGAAAGGTAAGGG - Intronic
910519024 1:88096795-88096817 AGGTAAGGCTAGGAGAGGGAAGG - Intergenic
910882062 1:91930670-91930692 TAGTAATACTTGAAGATTGACGG - Intergenic
911680934 1:100714373-100714395 AAGTAAATTTAGAAGAGGGAAGG + Intergenic
912851699 1:113131371-113131393 CAGAAATGCTAGAAGTGTAAAGG + Exonic
916841053 1:168601102-168601124 AGGTAATGGGAGAAGAATGAAGG + Intergenic
918017838 1:180654244-180654266 AAGTAGTTTTAGTAGAGTGATGG - Intronic
918283334 1:183026722-183026744 AAGAAAGGCTAGAAAAGTGGTGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918761541 1:188417017-188417039 AGGTAAAGGAAGAAGAGTGATGG - Intergenic
920692199 1:208155473-208155495 AAAAAATCCTAGAAGAGTGGGGG - Intronic
921105971 1:211978820-211978842 AAGTAATGATAATACAGTGATGG - Intronic
922410091 1:225365179-225365201 AAGAAATGCTAGAGAAGTGAAGG - Intronic
922653601 1:227361782-227361804 AAGTAATTCTGGAAGAGTTGAGG + Intergenic
1063790494 10:9440036-9440058 AACTAAAGGTAGAAGAGTAATGG + Intergenic
1063808749 10:9679557-9679579 CAGTAATCAGAGAAGAGTGATGG - Intergenic
1064171671 10:13039109-13039131 AAAGAAAGCTAGAAGAGGGATGG - Intronic
1065715126 10:28559426-28559448 AAGTAATGCAAGATGAGTTCAGG + Intronic
1071063991 10:81609317-81609339 AAGTAATTTTGCAAGAGTGAGGG + Intergenic
1071071124 10:81695426-81695448 AAGTAAGGATAGAAAAGTCAAGG + Intergenic
1073983027 10:109176429-109176451 GAGTTATTCTAGAAGAATGAGGG - Intergenic
1076256073 10:129025758-129025780 AAGTAGGGCTTGAAGAGGGAGGG - Intergenic
1077763983 11:5137037-5137059 AAGTAATGTGACAATAGTGAAGG + Intergenic
1078279493 11:9885891-9885913 AAGTCATGCCAGAAGATTGGGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079033381 11:17002124-17002146 AAGGCAGGGTAGAAGAGTGATGG - Intronic
1079898834 11:26155573-26155595 TAGAAATGGTAGAAGAGTGATGG - Intergenic
1081046925 11:38286313-38286335 AAGTAATGCTAGAATAAAGTAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1084300300 11:68245847-68245869 AAATTATCCTTGAAGAGTGAAGG + Intergenic
1086221727 11:84453434-84453456 TAGTAAGGCTAGAAGAGAAATGG + Intronic
1086254514 11:84859556-84859578 AAGTAATGTTAGAAGATCAAAGG + Intronic
1086829077 11:91536811-91536833 AAGTAATTCAAGAAAAGTAAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087542891 11:99543474-99543496 AAGTAAGTCTAGCAGAGTTATGG - Intronic
1087601062 11:100316284-100316306 AATAAATGCTTGATGAGTGAAGG - Intronic
1087629887 11:100637589-100637611 ATTTAATGCTAGAATAGGGAAGG + Intergenic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1088893532 11:114061568-114061590 AAGCAGTGTTCGAAGAGTGAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091521145 12:1244051-1244073 AAATAATGCTAGGAGAGTTGTGG + Intronic
1092380926 12:7996470-7996492 AAGTAAAAATAGAAGAGTGATGG - Intergenic
1092656490 12:10690162-10690184 AAAGAATGCTATAAGAATGAGGG + Intergenic
1093197118 12:16142637-16142659 AAGCTATACTAGGAGAGTGAAGG + Intergenic
1096580913 12:52584446-52584468 ATGTAATGCTTGAAGATGGATGG + Intergenic
1096756873 12:53806944-53806966 ATCTTATGATAGAAGAGTGAAGG + Intergenic
1097043373 12:56169787-56169809 AAGGAGTCCGAGAAGAGTGATGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1099642415 12:85308902-85308924 AACTGATGCTAGATGAGGGATGG - Intergenic
1100492677 12:95096512-95096534 CAGTAATGCTAGAATAGTAGCGG - Intronic
1100759552 12:97792237-97792259 AAATAAAGCCAGAACAGTGAAGG + Intergenic
1100916452 12:99428892-99428914 AAGGAATGCTCAAAGAGTGATGG + Intronic
1101165775 12:102030838-102030860 TGATAAAGCTAGAAGAGTGAAGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102570168 12:113822683-113822705 CAGTAATGCATGAAGAGTGCCGG - Intronic
1105489825 13:20877257-20877279 AAGGAAGGAGAGAAGAGTGAAGG - Intronic
1108577146 13:51800396-51800418 AGGAAATACTAGAAGAGTAAAGG - Intronic
1110088336 13:71411208-71411230 AACTAATGCTAGCACAGTTATGG - Intergenic
1113219996 13:108089107-108089129 GAGAAATGATAGAAGAGAGAAGG + Intergenic
1114379021 14:22180633-22180655 AACTATTGCTAGAGGAGTGAGGG + Intergenic
1115356005 14:32448388-32448410 AATTATTACTAGAAGAGTAAAGG - Intronic
1115451435 14:33552200-33552222 AAGAAATGCTGGAAGAGGCAAGG + Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117361804 14:54982618-54982640 AACTAATGTTTGCAGAGTGAGGG - Intronic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1118966018 14:70586337-70586359 AAGAATTGCTTGCAGAGTGAAGG - Intronic
1119987135 14:79150546-79150568 AACTAAAGCTGGAAGTGTGAAGG - Intronic
1121473866 14:94175655-94175677 AAGAAATGCTAAAAGGGAGATGG - Intronic
1124944818 15:34254894-34254916 AAGTAGTGATAGTAGAGTCAGGG - Intronic
1125392523 15:39209762-39209784 AAGTACTGCGAGCATAGTGATGG - Intergenic
1127670508 15:61189893-61189915 AAATAATGCTGGAATAATGATGG - Intronic
1127720743 15:61696767-61696789 GAGCAATGCTAGAAGAGACAAGG - Intergenic
1128892874 15:71346523-71346545 AAGAAGTGCTCAAAGAGTGATGG - Intronic
1129634431 15:77300008-77300030 AAGTAGAGCTCGAAGAATGAGGG - Intronic
1129648483 15:77461062-77461084 CAGAAAAGCCAGAAGAGTGAAGG + Intronic
1130056676 15:80532305-80532327 AAGCAATGGTAGAAGACTGGGGG - Intronic
1130358866 15:83161471-83161493 TAATAATGCCAGAAGAGTCAGGG + Intronic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1132221397 15:100108153-100108175 AAGGAATGCGAGAAGAAGGAAGG - Intronic
1138078806 16:54069126-54069148 AAGGAATGCTAGAAGATCCATGG + Intronic
1139346285 16:66305966-66305988 TAGTCATGGCAGAAGAGTGAAGG - Intergenic
1140653275 16:77112258-77112280 AAGCAATACTAGAAGAATCAGGG + Intergenic
1141759086 16:86015476-86015498 AAAGAATGGTAGAACAGTGAAGG + Intergenic
1146061027 17:29607487-29607509 AAGTAACTCTGGAAGAGGGAGGG - Intronic
1149984937 17:61340230-61340252 AAGAAATACTAGCATAGTGATGG + Intronic
1151429732 17:74054354-74054376 AATTATTGCTGGAAGAGAGATGG - Intergenic
1153443298 18:5145130-5145152 AAGACATGCTAGAAAGGTGAGGG - Intergenic
1153543187 18:6179308-6179330 AATTAAAGCTAGAAGAGTTCAGG - Intronic
1156787534 18:40933275-40933297 AAGCATTGATTGAAGAGTGAGGG - Intergenic
1157082785 18:44545937-44545959 AAGTAAAAAAAGAAGAGTGAAGG - Intergenic
1158106572 18:53891398-53891420 AAGAAATGATAGCAGAATGAAGG + Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1168131270 19:54321052-54321074 AAGTAAAGCTATAAAAGTAAAGG + Intergenic
1168179092 19:54647997-54648019 AAGTAAAGCTAAAAAAGTAAAGG - Intronic
925657745 2:6167636-6167658 AGGTAATGGGGGAAGAGTGAGGG + Intergenic
927287652 2:21373202-21373224 AAGAAATGCTATAAGACAGAAGG - Intergenic
928369383 2:30730128-30730150 AAAGAATTCTAGAAGACTGATGG + Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
930547540 2:52787970-52787992 AAGTAATGATTAAAGAGTAAAGG + Intergenic
932120227 2:69091944-69091966 AATGAATGAAAGAAGAGTGATGG - Intronic
932522156 2:72426241-72426263 AAGTAAGGTTAGAAAAGTGTTGG - Intronic
932796060 2:74697437-74697459 AAGTAATCCTGGAGAAGTGAGGG + Intergenic
933696031 2:85218212-85218234 AAGTAAAGTTAGAAAAGTGTGGG - Intronic
934076695 2:88434489-88434511 AAGTAATGCAAGCAGAAAGATGG - Intergenic
937050878 2:118888151-118888173 AAGTGATGCAAGTACAGTGATGG - Intergenic
941266069 2:163364846-163364868 AAGTCATCCTTCAAGAGTGAAGG - Intergenic
942506492 2:176646826-176646848 AAGTATTACTAAAAGATTGAAGG - Intergenic
943053825 2:182950143-182950165 CAGCCATGCTAGAAAAGTGAAGG + Intronic
944846043 2:203668849-203668871 AAGTGATGCTAAAAAAGTAAAGG - Intergenic
945465356 2:210163285-210163307 AGGTAATGTAAGAAGAGAGATGG + Intronic
945525677 2:210885425-210885447 AAGCAATATTGGAAGAGTGAAGG + Intergenic
947087301 2:226467644-226467666 AAGCACTGCTAGAAAAGGGATGG - Intergenic
1168974187 20:1951840-1951862 AAGGCAGGCAAGAAGAGTGAAGG - Intergenic
1169797821 20:9483960-9483982 AGGTAATGCTAGGAGAGGAAAGG - Intergenic
1170949978 20:20927644-20927666 AACTAATGCTAGAAAACTGCAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172807552 20:37623208-37623230 CAGGAATACTAGAAGAGAGATGG + Intergenic
1175339496 20:58219072-58219094 AGGGAATGCTGGAAGAGTAATGG - Intronic
1177078832 21:16613376-16613398 AAATAAAACTAGAGGAGTGAGGG - Intergenic
1178102033 21:29280437-29280459 AAGTAATGTTAATAGAGAGAAGG + Intronic
1178431720 21:32523496-32523518 AAATAAGGCTAAAAGGGTGAAGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
949339719 3:3016316-3016338 AAGTAATAACAGAAGAGGGAAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955529579 3:59859149-59859171 AAGAAATGCTCAAAGAATGATGG + Intronic
955817170 3:62856517-62856539 AAAAAATGCAAGAAGAGTCATGG + Intronic
956145706 3:66188800-66188822 CAGTAATGTTTGAAGAGTAAGGG - Intronic
960432180 3:117582504-117582526 AAGTCTTGCTAGAATTGTGAGGG - Intergenic
962456941 3:135573442-135573464 AAGTAATTCCAGAAGGGTAAGGG + Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
966089800 3:176119207-176119229 ATGGAATGTTAGAAGTGTGACGG + Intergenic
966507590 3:180724382-180724404 AATATATGCTAGAAGAGTGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966738525 3:183210616-183210638 AAGTAATTCTAGAAGAGGCTAGG + Intronic
967895351 3:194391291-194391313 TAGAAATGCTAGAAAAATGAAGG + Intergenic
969100397 4:4763955-4763977 AAGCATTCCTAGAGGAGTGAGGG + Intergenic
970925107 4:21442735-21442757 AAGTAATGATAGAAGAAGAATGG - Intronic
971348395 4:25833562-25833584 CAGTAAACCTATAAGAGTGAGGG + Exonic
971735731 4:30448754-30448776 AAGCTATGTTAGAAGAGTGGAGG + Intergenic
971877240 4:32323162-32323184 AGGGAATGCTTGAAGAGTAAAGG + Intergenic
972070362 4:35011895-35011917 AAGGAATACTAGAAAAGAGATGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973147571 4:46846891-46846913 TAGTGAGGCTAGAAGAGTGTGGG + Intronic
974080831 4:57210860-57210882 AATAAATGCTAGACTAGTGAAGG + Intergenic
975869321 4:78760779-78760801 AAATAATACTAGAAGACAGATGG + Intergenic
977382163 4:96289385-96289407 AAGTAATGATAGTAGAGGAAGGG - Intergenic
977409635 4:96645408-96645430 AAGGACTACTAGAAGAGGGAGGG - Intergenic
977798207 4:101193790-101193812 AAAAAATGCTAAAAGAATGAAGG + Intronic
978402273 4:108343290-108343312 ATGTAAGGCCAGAAGAGTGCTGG - Intergenic
978456061 4:108893228-108893250 AGGTAATGCTAAGAAAGTGAAGG + Intronic
979647337 4:123086926-123086948 GAGTAATGTAAGCAGAGTGATGG - Intronic
982747994 4:159124975-159124997 AAGTTAGGCTAGAAAACTGAAGG - Intronic
983012938 4:162571633-162571655 AAGTAAAGCTATAAAAATGATGG - Intergenic
983505464 4:168548192-168548214 AAGAAATTCTAAAAGATTGAAGG + Intronic
985169626 4:187135198-187135220 AAGTAATGCCACAGGAGTAAAGG - Intergenic
985872919 5:2572037-2572059 TAATAATGCTATGAGAGTGAGGG - Intergenic
986275114 5:6267583-6267605 AAGTGATGGTAGGAGAGAGAGGG + Intergenic
986591203 5:9372832-9372854 AAGGCATGCTGGATGAGTGAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992883708 5:81136380-81136402 AAGTTATGCTTCAAAAGTGAAGG - Intronic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
993080908 5:83299614-83299636 AAGAAAGGCTAGAAGAATTATGG - Intronic
993734167 5:91456477-91456499 AAGTAATTCTGGAGGAGTTAAGG - Intergenic
994007734 5:94859738-94859760 ACGTGATGTTAGTAGAGTGATGG - Intronic
994647884 5:102492260-102492282 AAGTAATGTAAGGAGAGAGATGG + Intronic
994783348 5:104121101-104121123 AAGTAATGATAATAGAGTAATGG + Intergenic
996898383 5:128513745-128513767 ATGTAATGCTAGAAGAGAAGTGG - Intronic
997518844 5:134509198-134509220 AAGGAATGCTCGAAGGGTGATGG + Intergenic
997633983 5:135390939-135390961 GAGTGATGTTAGAAGAGTAAAGG + Intronic
1000096662 5:157977277-157977299 AAGAAATGCTACAACAGAGAGGG + Intergenic
1001532901 5:172477117-172477139 AAATATTGAAAGAAGAGTGATGG + Intergenic
1001785440 5:174408738-174408760 AAGCAATGCTGGAATAGTGTAGG - Intergenic
1005209575 6:23444887-23444909 ATGTAATGCTAGAAGAGGTCAGG + Intergenic
1005797986 6:29387861-29387883 AAATTTTGGTAGAAGAGTGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007083660 6:39127391-39127413 AAATAATCCCAAAAGAGTGATGG - Intergenic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011821447 6:91257614-91257636 AAGTAATGATAATAGACTGAGGG + Intergenic
1011935046 6:92766228-92766250 AAGTAATGATAGAAGCATGTAGG - Intergenic
1012976167 6:105783401-105783423 ATGGAGTGCTAGAAGAGTGCTGG - Intergenic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1017024911 6:150173219-150173241 AAGACATGCTAGAAGAGACAGGG - Intronic
1017285138 6:152665956-152665978 AAGTAATTATTGATGAGTGAGGG + Intergenic
1019412575 7:912691-912713 AATAAATGCAAGAGGAGTGAGGG - Intronic
1020329247 7:7001440-7001462 AGGTAAGCCTAGAAGAGTAAAGG + Intergenic
1021599669 7:22352831-22352853 AATAAATGCAAGAAGAATGATGG + Intronic
1022763359 7:33381290-33381312 CAGTGATGGCAGAAGAGTGATGG + Intronic
1024204988 7:47150441-47150463 AAATAATTGCAGAAGAGTGATGG - Intergenic
1028392488 7:90333274-90333296 AAATAATTCTAAAAGAATGATGG - Intergenic
1028927562 7:96375740-96375762 AAGTTACACTAGAATAGTGATGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030240059 7:107312739-107312761 GAGTAATGGAAGAAGAGTGGAGG + Intronic
1030423606 7:109342030-109342052 ATGTAATGTTAGAATAGTCATGG + Intergenic
1030540737 7:110827429-110827451 ACCTAATGCTTGATGAGTGAAGG - Intronic
1031706462 7:124985959-124985981 AAATAATTCTTCAAGAGTGAGGG + Intergenic
1034007278 7:147487479-147487501 AAATTATGCTAGTGGAGTGAAGG - Intronic
1034210663 7:149359296-149359318 AAGTCAGGCAAGTAGAGTGATGG - Intergenic
1034325988 7:150233693-150233715 GTGTAATGTAAGAAGAGTGATGG - Intergenic
1034375842 7:150643149-150643171 AGGCACTGCTACAAGAGTGATGG + Intergenic
1034767221 7:153735565-153735587 GTGTAATGTAAGAAGAGTGATGG + Intergenic
1034857798 7:154569184-154569206 AAGTAATTTTAGAAAAGGGAGGG + Intronic
1036036359 8:5023863-5023885 AAGAAATGCTAAAAGAAAGAAGG + Intergenic
1036048229 8:5167368-5167390 ATGTAAAGTTAGAAAAGTGATGG - Intergenic
1036478598 8:9117640-9117662 AAGTAATGCAGGAAGAGGCATGG + Intergenic
1036669857 8:10776050-10776072 AATGAATGCTAGAATTGTGATGG - Intronic
1037357431 8:18036925-18036947 AAGCAATGCTAGAATACTGTGGG - Intergenic
1038248935 8:25884503-25884525 AAGTAAGGGAAGGAGAGTGAGGG - Intronic
1038862603 8:31403663-31403685 ATGAAAGGCTAGAAGAATGAGGG - Intergenic
1041126442 8:54644987-54645009 AAGTCATGCTGGAATAGTGTAGG - Intergenic
1041312843 8:56533996-56534018 AAGGGATGCTTGAAGAATGAGGG + Intergenic
1041871466 8:62639276-62639298 AAGTAATTCCAGAAGAGAGGTGG + Intronic
1042027513 8:64439684-64439706 CAGCAAGGCTAGAAGAGTGCTGG - Intergenic
1042151372 8:65789186-65789208 AAGTAATGTTGGAAGAGGGGAGG + Intronic
1042773437 8:72403720-72403742 AAGTCATCCTGGAAGGGTGAAGG + Intergenic
1042861643 8:73320175-73320197 AATTAATGCAAGAAGAATAAAGG - Intronic
1043417371 8:80064860-80064882 TAGTTATGGCAGAAGAGTGAAGG + Intronic
1043522457 8:81061175-81061197 GAGTAATGCTATAAGAAGGAAGG - Intronic
1043542259 8:81277453-81277475 AAGGAAAGCCAGATGAGTGAGGG + Intergenic
1044923388 8:97188659-97188681 AAGTAAAGATTGAAGAGTAATGG - Intergenic
1046178613 8:110612379-110612401 ATTTAATGTTACAAGAGTGATGG - Intergenic
1046816135 8:118585870-118585892 CAGTGATGCTAGAAGAGTTGAGG + Intronic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1048366296 8:133741749-133741771 AAGCAAACCTAGAAGAGTGCTGG + Intergenic
1049140290 8:140948547-140948569 AAGTAATGCAGGAAGAGATATGG + Intronic
1050256545 9:3798066-3798088 AAGTAACAATAAAAGAGTGAGGG - Intergenic
1050604221 9:7283830-7283852 TGTTAAAGCTAGAAGAGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1050937284 9:11414160-11414182 AAGAAAAGATAGAAGAGAGATGG + Intergenic
1051698406 9:19792992-19793014 CAGTAATGGGAGGAGAGTGAGGG - Intergenic
1052043516 9:23768255-23768277 AAACAAAGCTAGAAGAGTGAAGG - Intronic
1052540653 9:29807971-29807993 AAGTAAAACTAGAAGACAGAGGG - Intergenic
1052656095 9:31363313-31363335 CAGTAATGAAAGCAGAGTGATGG + Intergenic
1055581696 9:77712750-77712772 AGGGAATGCTAGAAGGGTGCAGG + Intergenic
1055770727 9:79714309-79714331 ATGTAATGCTATAAAAGGGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1059313415 9:113404316-113404338 CAGTAATGATAGAAGTGTGGTGG + Intergenic
1059526779 9:114999353-114999375 AAGTAATGGTTAAGGAGTGAGGG + Intergenic
1059861027 9:118461981-118462003 GAGTATTGCTATAAGAGTGATGG - Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186717651 X:12269566-12269588 AAGTAATGCTATTATAGTGGTGG + Intronic
1187558369 X:20374700-20374722 CAGTAAGGAGAGAAGAGTGATGG - Intergenic
1187829331 X:23364988-23365010 AAGTACTTCTTGAAGAGTTACGG + Intronic
1188536837 X:31205967-31205989 AGCCAATGCTAGAGGAGTGATGG - Intronic
1189895399 X:45650242-45650264 AAGTAATGCAGGATGAGTGATGG + Intergenic
1190505727 X:51124443-51124465 AAGTAATATTTTAAGAGTGAAGG - Intergenic
1190575525 X:51832753-51832775 TAGTAATTCCTGAAGAGTGAAGG - Intronic
1192122034 X:68465343-68465365 AAGGAATGCTCAAAGAATGAAGG + Intergenic
1192710670 X:73581993-73582015 AAATAGTGTTAGAAGACTGAGGG - Intronic
1193734274 X:85138018-85138040 AGGTAATGTTAGCAGAGAGATGG - Intergenic
1194444390 X:93969737-93969759 GAGAAAGCCTAGAAGAGTGAAGG + Intergenic
1195719511 X:107852931-107852953 AAGGACTGCTAGCAGAATGAGGG + Intronic
1195939875 X:110159276-110159298 AAGAAAGGCTAGAAGAGAGCTGG + Intronic
1196081055 X:111631517-111631539 AAGTAATGCAAAAAGAGTTATGG + Intergenic
1197570573 X:128146473-128146495 AAGGTCTGCTAGAAGAGTGCTGG - Intergenic
1197897306 X:131328822-131328844 AGGTCATGATATAAGAGTGAGGG + Intronic
1198650880 X:138862853-138862875 TAGTAATGCTTGGAGAATGAGGG - Intronic
1199588610 X:149443031-149443053 AAGAAATGCTCAAAGAATGAAGG + Intergenic
1199910415 X:152280881-152280903 GAGTAATGTTAGGAGAGTCAGGG - Intronic
1200175596 X:154113719-154113741 AAGTTATCCTTCAAGAGTGATGG - Intergenic