ID: 1162330141

View in Genome Browser
Species Human (GRCh38)
Location 19:10023031-10023053
Sequence TTGTATATTCTTAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162330136_1162330141 -6 Left 1162330136 19:10023014-10023036 CCGCGCCCGGCCAACTTTTGTAT 0: 3
1: 369
2: 10639
3: 64313
4: 146593
Right 1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG No data
1162330135_1162330141 -3 Left 1162330135 19:10023011-10023033 CCACCGCGCCCGGCCAACTTTTG 0: 5
1: 118
2: 1462
3: 20559
4: 110149
Right 1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG No data
1162330132_1162330141 28 Left 1162330132 19:10022980-10023002 CCTCGCAAAGTGCTGGGATTACA 0: 1144
1: 302864
2: 268344
3: 150612
4: 131701
Right 1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162330141 Original CRISPR TTGTATATTCTTAAAGAGGA AGG Intergenic
No off target data available for this crispr