ID: 1162331236

View in Genome Browser
Species Human (GRCh38)
Location 19:10031083-10031105
Sequence CCGATTTGACACCAGAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162331230_1162331236 6 Left 1162331230 19:10031054-10031076 CCAGGAAGGAATGCCTGAAAGAG No data
Right 1162331236 19:10031083-10031105 CCGATTTGACACCAGAGTTGGGG No data
1162331231_1162331236 -7 Left 1162331231 19:10031067-10031089 CCTGAAAGAGTGTTGCCCGATTT No data
Right 1162331236 19:10031083-10031105 CCGATTTGACACCAGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162331236 Original CRISPR CCGATTTGACACCAGAGTTG GGG Intergenic
No off target data available for this crispr