ID: 1162331483

View in Genome Browser
Species Human (GRCh38)
Location 19:10032594-10032616
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162331483_1162331498 7 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331498 19:10032624-10032646 AATTGCTGGGCAGGGGCAGGGGG No data
1162331483_1162331491 -6 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG No data
1162331483_1162331492 -2 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331492 19:10032615-10032637 CGAAGGGGAAATTGCTGGGCAGG No data
1162331483_1162331493 -1 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331493 19:10032616-10032638 GAAGGGGAAATTGCTGGGCAGGG No data
1162331483_1162331501 19 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331501 19:10032636-10032658 GGGGCAGGGGGACCGGCCACGGG No data
1162331483_1162331490 -7 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331490 19:10032610-10032632 CCTCTCGAAGGGGAAATTGCTGG No data
1162331483_1162331499 12 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331499 19:10032629-10032651 CTGGGCAGGGGCAGGGGGACCGG No data
1162331483_1162331496 5 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331496 19:10032622-10032644 GAAATTGCTGGGCAGGGGCAGGG 0: 2
1: 0
2: 1
3: 47
4: 424
1162331483_1162331494 0 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331494 19:10032617-10032639 AAGGGGAAATTGCTGGGCAGGGG 0: 2
1: 0
2: 4
3: 52
4: 468
1162331483_1162331502 20 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331502 19:10032637-10032659 GGGCAGGGGGACCGGCCACGGGG No data
1162331483_1162331497 6 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331497 19:10032623-10032645 AAATTGCTGGGCAGGGGCAGGGG No data
1162331483_1162331500 18 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331500 19:10032635-10032657 AGGGGCAGGGGGACCGGCCACGG No data
1162331483_1162331495 4 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331495 19:10032621-10032643 GGAAATTGCTGGGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162331483 Original CRISPR CGAGAGGTGGCAGGAGCCGA AGG (reversed) Intergenic
No off target data available for this crispr