ID: 1162331491

View in Genome Browser
Species Human (GRCh38)
Location 19:10032611-10032633
Sequence CTCTCGAAGGGGAAATTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162331482_1162331491 5 Left 1162331482 19:10032583-10032605 CCTGGACTATTCCTTCGGCTCCT No data
Right 1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG No data
1162331483_1162331491 -6 Left 1162331483 19:10032594-10032616 CCTTCGGCTCCTGCCACCTCTCG No data
Right 1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162331491 Original CRISPR CTCTCGAAGGGGAAATTGCT GGG Intergenic
No off target data available for this crispr