ID: 1162335704

View in Genome Browser
Species Human (GRCh38)
Location 19:10058959-10058981
Sequence GAAGCATCCCACACCCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162335704_1162335712 8 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335712 19:10058990-10059012 CCTCAGTCATGGAGTGGGGAGGG 0: 1
1: 0
2: 6
3: 19
4: 313
1162335704_1162335713 9 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335713 19:10058991-10059013 CTCAGTCATGGAGTGGGGAGGGG 0: 1
1: 1
2: 4
3: 43
4: 507
1162335704_1162335709 4 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335709 19:10058986-10059008 TCAACCTCAGTCATGGAGTGGGG 0: 1
1: 0
2: 0
3: 20
4: 157
1162335704_1162335708 3 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335708 19:10058985-10059007 ATCAACCTCAGTCATGGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1162335704_1162335710 7 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335710 19:10058989-10059011 ACCTCAGTCATGGAGTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 169
1162335704_1162335706 -3 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335706 19:10058979-10059001 TTCTTAATCAACCTCAGTCATGG 0: 1
1: 0
2: 0
3: 8
4: 114
1162335704_1162335707 2 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335707 19:10058984-10059006 AATCAACCTCAGTCATGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 122
1162335704_1162335714 10 Left 1162335704 19:10058959-10058981 CCCTAGTGGGTGTGGGATGCTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1162335714 19:10058992-10059014 TCAGTCATGGAGTGGGGAGGGGG 0: 1
1: 0
2: 5
3: 50
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162335704 Original CRISPR GAAGCATCCCACACCCACTA GGG (reversed) Intergenic
900341665 1:2192331-2192353 GAAGCATTCCAGACACACCAAGG + Intronic
901737224 1:11320169-11320191 GAAGCACTCCACTCCCACTCCGG + Intergenic
903830091 1:26169574-26169596 AAAGCATCCCACCCCCACCGCGG + Intergenic
903961207 1:27058962-27058984 CAAGCATCCCACAGCCTCTGGGG + Intergenic
904900975 1:33856744-33856766 TAAACATCTCACACACACTAAGG + Intronic
907666171 1:56435641-56435663 GAAGTACCCCCCACCCATTAGGG + Intergenic
913230265 1:116735490-116735512 CAACCATCCCACACACACTCAGG - Intergenic
916474925 1:165160065-165160087 GAAACATCACACACCCACACTGG - Intergenic
921071368 1:211660913-211660935 GATTCATCCCTCACCCACTGGGG - Intronic
922184245 1:223259868-223259890 GGAGCCTCTCACACACACTAGGG + Intronic
923536850 1:234859093-234859115 TAAGCATCCCACCCCAATTATGG + Intergenic
924709909 1:246523245-246523267 GAAGCCCCCCACACCCTGTATGG - Intergenic
1063440992 10:6072920-6072942 AATTCATCCCACACCCACCAGGG - Intergenic
1064118264 10:12597273-12597295 GAAGCATCCATCACCCCCTTGGG + Intronic
1065663651 10:28034671-28034693 GAAGTATCCCACACCCATGCTGG - Intergenic
1067462110 10:46465744-46465766 GGAGCATCCTACCCCCACTGTGG - Exonic
1067625085 10:47918854-47918876 GGAGCATCCTACCCCCACTGTGG + Intergenic
1073424152 10:103446144-103446166 GTCTCATCCCACGCCCACTATGG + Exonic
1075456452 10:122588169-122588191 GAATCTTCTCACCCCCACTAGGG + Intronic
1075808101 10:125204621-125204643 GCACCATCCCACAGCCAGTAAGG - Intergenic
1076503490 10:130955705-130955727 GAGACACCACACACCCACTAGGG - Intergenic
1085381510 11:76123466-76123488 GAAGCATTCCACAAACACTACGG - Intronic
1091209293 11:133842918-133842940 GCATCACCCCACACCCACTGTGG + Intronic
1103389660 12:120562748-120562770 AAAGCATGCAATACCCACTAAGG - Intronic
1105071634 12:133237180-133237202 GAATCACCCCAGACCCACCAGGG - Intergenic
1106645107 13:31625678-31625700 AAAGCAACCCAAACCCACAAGGG - Intergenic
1110352520 13:74525919-74525941 CAAGCACCACAGACCCACTATGG + Intergenic
1112235710 13:97634473-97634495 CCAGCTTCCCACACCCACTGTGG - Intergenic
1117012193 14:51482333-51482355 GCAGAACCCCACACCCACTTTGG + Intergenic
1117335620 14:54755001-54755023 GAAGCTTCCCCCACCTGCTATGG - Intronic
1118797295 14:69154136-69154158 AAAGCATTTAACACCCACTAGGG - Intergenic
1123810941 15:23925699-23925721 GAAGACTCCCACAATCACTAGGG + Intergenic
1124906321 15:33872088-33872110 GGAGCAGACAACACCCACTAAGG + Intronic
1125875541 15:43140879-43140901 GATTCATCCCTCACCCACTGGGG - Intronic
1128977946 15:72167092-72167114 GAAGCATCCCTCTCCCTCTCAGG - Exonic
1129771293 15:78204980-78205002 GGAAACTCCCACACCCACTAAGG - Intronic
1131467528 15:92667688-92667710 GATGCATCCTAGACCCACTTTGG + Intronic
1131939446 15:97544830-97544852 GGAGCATCACACCCACACTATGG + Intergenic
1132436917 15:101813971-101813993 GATGCATCCCAAACCCTCCATGG - Intronic
1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG + Intronic
1137482482 16:48864235-48864257 GAAGCAGCTCTCAACCACTAGGG + Intergenic
1138133173 16:54499548-54499570 GAAGCATGACTCACCCACTCTGG - Intergenic
1139939968 16:70598158-70598180 GAAGCATCTCAGACCCTTTAAGG - Intronic
1142276463 16:89121353-89121375 GAATCTCCCCACACCTACTATGG - Intronic
1143593895 17:7902747-7902769 CAGGCCTCCCACACCCACCAGGG - Intronic
1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG + Intronic
1152420811 17:80192045-80192067 CAAGCATCCCACACCGACGGTGG + Intronic
1152562070 17:81083575-81083597 GAAGCATGCCACAGCCCCTCAGG - Intronic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1162439879 19:10686391-10686413 GAGCCTTCCCACACCCACTGTGG + Intronic
1163222012 19:15928678-15928700 GAAGCATCCCACAGAAACTATGG - Intronic
925459832 2:4051331-4051353 GAAGGATGCCACACAGACTATGG + Intergenic
925746028 2:7044499-7044521 GAAGCATCTCATCCCCACTCAGG + Intronic
926441726 2:12895842-12895864 AAAGCATCCAAGAACCACTAGGG - Intergenic
929580779 2:43080712-43080734 GAAGCAGCTCCCACCCACCAGGG + Intergenic
937360423 2:121225537-121225559 GAAGCCTCCCCCTCCCCCTAGGG - Intronic
939585197 2:143996059-143996081 GCAGCTTTCCACATCCACTAAGG + Intronic
940392458 2:153148208-153148230 GAAGCATTCAACACCCACAAAGG - Intergenic
942144284 2:173011066-173011088 GAAGAACCCCACAGCCTCTAGGG - Intronic
944344123 2:198639769-198639791 AAATCATCCCACACCCAGTTAGG - Intergenic
1174062199 20:47840651-47840673 GAAGCTGCGCACACCCTCTAGGG + Intergenic
1176388736 21:6152572-6152594 GATGCATACCACACACACCAGGG + Intergenic
1177121634 21:17144185-17144207 GAATCATCCCCCTCCCTCTAGGG + Intergenic
1177195025 21:17895109-17895131 AAAGTATACCACAGCCACTATGG - Intergenic
1179734736 21:43385676-43385698 GATGCATACCACACACACCAGGG - Intergenic
1183947666 22:41335905-41335927 CCAGCATCTCACACCCACTGTGG - Intronic
951631881 3:24730889-24730911 AAAGCATCCCACACCAAGTTTGG - Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
959427080 3:106204520-106204542 GAAGCTTCCCCCATCCACTATGG + Intergenic
961855052 3:129861671-129861693 GTACCATTTCACACCCACTAGGG + Intronic
969268151 4:6079510-6079532 GAACCATCACACACCCACTTTGG + Intronic
981849955 4:149218562-149218584 GAAGCAACCCACTCTCACCATGG + Intergenic
985370690 4:189282664-189282686 GATGCATCCCACTCACATTAGGG + Intergenic
987160118 5:15133019-15133041 GGAGCAGCCCACTCCCACCATGG - Intergenic
988973762 5:36495143-36495165 GATGCATCCCACCCCCTTTAAGG + Intergenic
992301195 5:75382061-75382083 GAAGCAGGCCACACCCTCTGTGG + Exonic
997241460 5:132311446-132311468 GCAGCATCCCACAGACCCTAGGG + Intronic
1001841089 5:174877288-174877310 GGTGCCTCCCACACCCACTGCGG - Intergenic
1003274472 6:4637439-4637461 GAGGCCTCCCTCACACACTATGG - Intergenic
1006636785 6:35466955-35466977 GGAGCATCCCATGCCCACTCTGG - Exonic
1006962982 6:37952695-37952717 GAAGTAGCCCACTCTCACTATGG - Intronic
1007243780 6:40445440-40445462 GAAGACTCCCCCACCAACTAGGG + Intronic
1007373976 6:41443890-41443912 GGAGCCTCCCACAGCCACTCTGG + Intergenic
1013359341 6:109379936-109379958 GAAGACACCCACAGCCACTAAGG + Intronic
1014141616 6:117949945-117949967 GAATCGTCCCCCACCCACTCTGG + Intronic
1019892096 7:3955014-3955036 GATGCATCTCACAGGCACTAAGG - Intronic
1020525318 7:9251439-9251461 GAAGCATACCACCTCCACCAAGG + Intergenic
1024483167 7:49886148-49886170 GAAGCATCCCACACTGAATTTGG + Intronic
1026072802 7:67137583-67137605 GAATCATTCCACTCCAACTAAGG - Intronic
1026704080 7:72674629-72674651 GAATCATTCCACTCCAACTAAGG + Intronic
1030614641 7:111725961-111725983 GATGCATTTCACACTCACTACGG - Intergenic
1031997933 7:128245178-128245200 GAATCTTCCCAAACCAACTATGG + Intronic
1032675670 7:134127755-134127777 GAAGCTTCCCACACCTTCTCAGG + Intronic
1036048057 8:5166062-5166084 GAAGCTTCCAAAACCCACTTTGG - Intergenic
1039554142 8:38465131-38465153 GAAGCGTCCCCCACTCCCTAGGG - Intronic
1041394754 8:57379035-57379057 AAAGCATCCAACACCCATAAAGG + Intergenic
1043270408 8:78326326-78326348 GAAGCATCACACAACCAGAAGGG + Intergenic
1044449581 8:92318900-92318922 GAAGCTTCCCTCCCCCAGTAAGG + Intergenic
1048691814 8:136974105-136974127 GAAGCATCTTACTCCCACAATGG + Intergenic
1048878355 8:138854152-138854174 CAAGCATCCCACAGTCACGATGG - Intronic
1055178402 9:73350656-73350678 AAAGCATCCAACAACCAATAGGG - Intergenic
1060151710 9:121293024-121293046 CAAGCCTCCCATACCAACTATGG - Intronic
1185494225 X:542202-542224 CACGCATTCCACACCCAATATGG + Intergenic
1185494246 X:542371-542393 CATGCATTCCACACCCAATATGG + Intergenic
1185494253 X:542417-542439 CATGCATTCCACACCCAATATGG + Intergenic
1185494261 X:542463-542485 CATGCATTCCACACCCAATATGG + Intergenic
1189246732 X:39569031-39569053 AAAGCATCCCACACCCCAGAAGG - Intergenic
1189497295 X:41520855-41520877 GAAACATGCCACCCCCACTCAGG + Intronic
1190643062 X:52498936-52498958 GAAGCATCTTACACCCACCTTGG - Intronic
1190644611 X:52513931-52513953 GAAGCATCTTACACCCACCTTGG + Intronic
1194224911 X:91244680-91244702 GAACCAGCCCCCACCCACAATGG - Intergenic
1196352473 X:114747770-114747792 GAAGCCTCCCACATCCAATGTGG + Intronic
1200561374 Y:4707990-4708012 GAACCAGCCCCCACCCACAATGG - Intergenic