ID: 1162337510

View in Genome Browser
Species Human (GRCh38)
Location 19:10070978-10071000
Sequence TGTTCTTCTCATGGGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162337510_1162337521 28 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337521 19:10071029-10071051 GCTGCAGGCGGAGTTCCTGCAGG 0: 1
1: 0
2: 1
3: 55
4: 242
1162337510_1162337519 13 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1162337510_1162337518 3 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337518 19:10071004-10071026 TGCTGGGCTTTCGGGTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 112
1162337510_1162337520 16 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337520 19:10071017-10071039 GGTTCACAGGATGCTGCAGGCGG 0: 1
1: 0
2: 3
3: 18
4: 268
1162337510_1162337516 -6 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337516 19:10070995-10071017 AGAACACGGTGCTGGGCTTTCGG 0: 1
1: 0
2: 0
3: 18
4: 145
1162337510_1162337517 -5 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337517 19:10070996-10071018 GAACACGGTGCTGGGCTTTCGGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162337510 Original CRISPR TGTTCTTCTCATGGGAGAGC TGG (reversed) Intergenic
900646635 1:3711887-3711909 TGTTTGTCTTAGGGGAGAGCTGG + Intronic
907678280 1:56538830-56538852 TGCACTTCTCTTGGTAGAGCAGG - Intronic
908116908 1:60949638-60949660 AGGTCTCCGCATGGGAGAGCTGG - Intronic
908210711 1:61896745-61896767 TGTTGTTCTCATGAGAGTGAGGG + Intronic
910013646 1:82495573-82495595 TCTTATTCACATGGCAGAGCAGG + Intergenic
910789590 1:91037254-91037276 TTTACTTCTCTTGGGAGAGGTGG + Intergenic
910925677 1:92396078-92396100 TTCTCTTCTCATGGAATAGCAGG - Exonic
913511856 1:119569349-119569371 TGTTCTTGATATGGGAGTGCTGG - Intergenic
913516083 1:119606661-119606683 TGTTCTTGATATGGGAGTGCTGG - Intergenic
915770777 1:158420593-158420615 TGGTCTTCTTCTGGGACAGCAGG + Exonic
915774281 1:158465813-158465835 TGGTCTTCTTCTGGGACAGCAGG - Exonic
917488178 1:175474327-175474349 TGTTCTTCTAAGAGGAGATCAGG + Intronic
917667425 1:177238674-177238696 TTTTCTTCCCATGGGAGAATTGG - Intronic
918097253 1:181345631-181345653 TGGGCTTCTCAGTGGAGAGCGGG + Intergenic
918222326 1:182446050-182446072 TGTACTTCTCATGTCACAGCAGG + Intergenic
920109665 1:203578527-203578549 TGTTTTCTTCCTGGGAGAGCTGG - Intergenic
920692503 1:208157860-208157882 GATTCTTCTCATAGGAGAGAAGG + Intronic
921988600 1:221339672-221339694 TGGTCTTCGTAGGGGAGAGCTGG - Intergenic
922289925 1:224201524-224201546 TATTCTTCTCTGGGGAGGGCTGG + Intergenic
922882577 1:228992095-228992117 TGTTATTTTAATGGGAGAGTAGG - Intergenic
924615057 1:245605776-245605798 CGCTCTTCTCAGTGGAGAGCCGG + Intronic
924671518 1:246131486-246131508 TGTTATTATCATGGTAGAGCAGG - Intronic
1066058796 10:31704522-31704544 CCTTCTTCACATGGCAGAGCAGG - Intergenic
1069409235 10:68135310-68135332 TGTTCCACTCATGGGAGGGTAGG - Intronic
1069736228 10:70656492-70656514 TGATGTTCTGGTGGGAGAGCAGG + Intergenic
1070113085 10:73503553-73503575 TGTTCTTTTCCTAGGAGAGTTGG - Intronic
1071109805 10:82142674-82142696 TGTATCTCTCATGGAAGAGCTGG + Intronic
1071557589 10:86617051-86617073 CCTTCTTCTCATGGCAGAGCAGG + Intergenic
1072674148 10:97453046-97453068 TGACCATCTCCTGGGAGAGCAGG + Intronic
1078462656 11:11526541-11526563 TGTATTTGTCAGGGGAGAGCTGG + Intronic
1078549088 11:12268278-12268300 TGTACAACTCTTGGGAGAGCTGG + Intergenic
1079455875 11:20635859-20635881 TTTTATTCTCACGGGTGAGCTGG - Intronic
1083377990 11:62241883-62241905 TGTTCTGGTTATGGGGGAGCAGG - Intergenic
1083384770 11:62299434-62299456 TGTTCTCTTTATGGGAGAGCAGG + Intergenic
1085016424 11:73177099-73177121 TCTTCTGCTCATGGGAGGGAAGG - Intergenic
1087506259 11:99026503-99026525 TGTTATTCTAATGTGTGAGCTGG + Intronic
1091917091 12:4277468-4277490 TGTTTTTCTCATGAGAGAGCAGG + Intronic
1095382389 12:41611350-41611372 CCTTCTTCACATGGTAGAGCAGG - Intergenic
1095434116 12:42168930-42168952 TGTTCTTATGATGGGAGGGGTGG - Intronic
1098521004 12:71435609-71435631 ACCTCTTCACATGGGAGAGCAGG + Intronic
1098602687 12:72351047-72351069 TGTTCAACACACGGGAGAGCTGG + Intronic
1099339076 12:81404154-81404176 TGTTCTTCTTATGGAGGAGGAGG - Intronic
1102255492 12:111412377-111412399 AGATCTTCTCAGGGGAGAGGCGG - Intronic
1102581563 12:113891510-113891532 TCTGCTTCTCAAGGCAGAGCTGG + Intronic
1106878089 13:34098093-34098115 TGTTTTTCTCAAGGGAGTGTTGG - Intergenic
1107689946 13:42943585-42943607 TGTTCTCCTTTTGGGAGGGCAGG - Intronic
1110329103 13:74250954-74250976 AGTTCTTCTCAAGGGAGCCCAGG + Intergenic
1114699986 14:24667011-24667033 TTTTCTGCTCATGGAATAGCTGG + Intergenic
1114964149 14:27936363-27936385 TTTTCTTCTAATGGGACAGGTGG + Intergenic
1119090030 14:71772844-71772866 TGTTCTTCTCAGGAGGAAGCTGG + Intergenic
1119349305 14:73950708-73950730 TGTTCTACTCATGGGAAAACAGG + Intronic
1119963694 14:78888874-78888896 TGTTCTTCTCATGCCAAATCTGG - Intronic
1120461658 14:84805119-84805141 GCTTCTTCACATGGCAGAGCAGG + Intergenic
1121139594 14:91529606-91529628 TGTTCTACTCAGATGAGAGCAGG + Intergenic
1123704048 15:22938153-22938175 TGTGTTTCTCATGGGAAAGATGG - Intronic
1127896606 15:63305730-63305752 AGTTCTTGTCTTGGCAGAGCAGG - Exonic
1129312367 15:74721621-74721643 TGATCTTCTCATCTGACAGCTGG + Exonic
1129544588 15:76381794-76381816 TTTTCTTCTCCTGGAAGACCAGG + Intronic
1130967560 15:88708546-88708568 CGTTCTTCACACTGGAGAGCTGG + Intergenic
1133419862 16:5636980-5637002 TGTTCTTCTTGTGGGAGTTCGGG + Intergenic
1134992832 16:18716065-18716087 TGTTCTTCTCATAGTGGATCAGG + Intergenic
1137620206 16:49871288-49871310 TGTTTTTATCTTGGGTGAGCTGG - Intergenic
1138124062 16:54424307-54424329 GGGTCATCTTATGGGAGAGCTGG + Intergenic
1138135182 16:54515377-54515399 AGTACTTCTGCTGGGAGAGCGGG + Intergenic
1139362568 16:66409878-66409900 CCTTCTTCACATGGCAGAGCGGG - Intergenic
1141204528 16:81923383-81923405 GGTTCTTCTCATTGGGGAGCAGG - Intronic
1141307943 16:82884235-82884257 TTTCCTTCTCATGGGAGCCCAGG - Intronic
1141948486 16:87325695-87325717 TTTCCTTCTCCGGGGAGAGCAGG - Intronic
1144585959 17:16487931-16487953 GCCTCTTCTCATGGGAAAGCTGG + Intronic
1144794467 17:17881663-17881685 TGTTCTACTGATGGGAGACCGGG + Intronic
1144882724 17:18438912-18438934 TGTTCTTCTGCTGGGAGTGTGGG + Intergenic
1145295739 17:21591628-21591650 TATTCTTCCCATGAGAGACCAGG - Intergenic
1145368042 17:22280429-22280451 TATTCTTCCCATGAGAGACCAGG + Intergenic
1147050559 17:37791113-37791135 AGTTCATCTCTTGGGAGAGTTGG + Intergenic
1148611630 17:48968529-48968551 TGTCCTTCTTCTGGAAGAGCTGG - Exonic
1149434331 17:56620180-56620202 TGCTCTGAACATGGGAGAGCTGG - Intergenic
1151128384 17:71870089-71870111 TGTTCTTTTCAGGGGACAGATGG - Intergenic
1154323411 18:13372238-13372260 TGTTCTTCGCAGGGCAGACCTGG + Intronic
1154941654 18:21119249-21119271 TGTGCTTCTCTGGGTAGAGCAGG + Intergenic
1155563708 18:27109593-27109615 TGTTTATTTCAAGGGAGAGCAGG + Intronic
1156461502 18:37323797-37323819 TGTTCTTCTCATTGAAAAGATGG - Intronic
1158263633 18:55636225-55636247 TGTGCTTCTCTGGGCAGAGCAGG - Intronic
1158789154 18:60754687-60754709 TGTTGTTCACATAGGAAAGCTGG - Intergenic
1159161452 18:64647290-64647312 TTTTTTTCTCATGGGAAAACTGG + Intergenic
1160263847 18:77321091-77321113 TGTTCTTCTGCTGGGATTGCTGG + Intergenic
1160961237 19:1721982-1722004 TGGTCTTCTCCTGTGTGAGCAGG - Intergenic
1161970690 19:7578234-7578256 GGTTCTGCTCCTGGCAGAGCAGG + Intergenic
1162337510 19:10070978-10071000 TGTTCTTCTCATGGGAGAGCTGG - Intergenic
1164825143 19:31279354-31279376 TGTTCTTCTCCGAGGAGGGCTGG + Exonic
1165114756 19:33522117-33522139 TGTTCTTCTCCCGGGTGGGCTGG - Intergenic
1166229136 19:41415378-41415400 AGCTCTCCACATGGGAGAGCTGG + Intronic
1166291458 19:41866313-41866335 TGTAGTTCAAATGGGAGAGCAGG + Intronic
1166447182 19:42868542-42868564 TGCTCTTATCATGGGAGACTTGG - Intronic
1166463891 19:43015557-43015579 TGCTCTTGTCATGGGAGACTTGG - Intronic
1166490763 19:43258643-43258665 TGCTCTTGTCATGGGAGACTTGG - Intronic
1166864448 19:45827512-45827534 TGTCCTTCTCATGGGAGCTGAGG + Exonic
925064891 2:922155-922177 TGGGCTTCTCAGGTGAGAGCAGG + Intergenic
925437094 2:3847867-3847889 TCTTTTTCACATGGCAGAGCAGG - Intergenic
925815057 2:7739282-7739304 TGCTGTTCTCATGGGAGTGAGGG + Intergenic
926311912 2:11681370-11681392 TGCTGTTCTCATGAGAGATCTGG + Intronic
926355090 2:12034250-12034272 TGTCCTTCTCATGGGATTCCTGG + Intergenic
929625932 2:43406793-43406815 TGTTCTCCTCATGCAACAGCTGG + Intronic
932876632 2:75459014-75459036 TGTTACTATCATGGGATAGCAGG + Intergenic
937645441 2:124261360-124261382 TGTTCTCTTCATGGGACAGTTGG - Intronic
938241449 2:129745202-129745224 TGTTCTTCTCTCAGGAAAGCTGG - Intergenic
940835241 2:158513949-158513971 TCAACTTCGCATGGGAGAGCGGG - Intronic
941549521 2:166897696-166897718 GGTTCAGCCCATGGGAGAGCAGG + Intronic
944945100 2:204675011-204675033 TGCTCTTCTCTTTGGAGAGATGG + Intronic
946362589 2:219228361-219228383 TGTTAGTCTCTTGGGAGACCAGG - Intronic
947216397 2:227754003-227754025 TTTTCTTCTCATGGGAACACTGG + Intergenic
948278995 2:236732038-236732060 TATTCATCTCAGGGGTGAGCAGG - Intergenic
948325449 2:237116133-237116155 TGTTCTTCCCATGGTAGAAGGGG - Intergenic
1168928447 20:1601767-1601789 TGTACTTCTCAAGGAGGAGCCGG - Intronic
1169621673 20:7513882-7513904 TGTTCTTGCAATGAGAGAGCAGG + Intergenic
1170182198 20:13544382-13544404 TGTTTTTCCCACTGGAGAGCTGG + Intronic
1171055741 20:21904445-21904467 AGTTCCTCTCAGGAGAGAGCAGG + Intergenic
1172956848 20:38766316-38766338 TGTTCTTCTCCTATGAGAGATGG - Exonic
1173413645 20:42837337-42837359 TGGTCTTCTGCTGGGAAAGCAGG + Intronic
1173522874 20:43712263-43712285 TGCTCTCCTCAAGGGAGAGCTGG + Intronic
1174741623 20:53020092-53020114 TGCTGTTCTCATGGTAGTGCGGG - Intronic
1177034314 21:16022974-16022996 TGATAATCTCATGGGAGAGAAGG - Intergenic
1181903081 22:26170927-26170949 TGTTCTTCTCCGGGGAGTTCTGG + Intronic
1183228433 22:36565910-36565932 TGTTCTACTCAGGTGGGAGCAGG - Intronic
1184856178 22:47147947-47147969 TGTGCTGCTCCTGGGAGGGCTGG + Intronic
950181306 3:10915339-10915361 TCTTCTGCTGATGGGAGAGATGG - Intronic
951921543 3:27860097-27860119 TGTTCTTCTCATGATGGATCTGG - Intergenic
952900954 3:38111535-38111557 TGCTCTTCCCAGGGGAGAGCTGG - Intronic
954692936 3:52405373-52405395 TGTTCTTCTCTGGGAAGTGCTGG - Intronic
954915071 3:54141887-54141909 TGTTCTTCTAATCCAAGAGCCGG - Intronic
955524104 3:59803390-59803412 TGCTCTTCACCTGGGTGAGCGGG + Intronic
958518562 3:95155494-95155516 CGATCTTCACATGGCAGAGCAGG + Intergenic
959082763 3:101819444-101819466 TGTTATTCTCATGATAGAGATGG + Intronic
961434563 3:126907870-126907892 TTTTCTTCCCAAGGGACAGCTGG + Intronic
961807889 3:129502326-129502348 TATTCTTCTCATCTGAGAGATGG + Intronic
962811907 3:138966245-138966267 AGTGCTTCTCATGGAAGACCAGG + Intergenic
963694804 3:148553125-148553147 TAGTTTTCTCATGGGAGGGCAGG - Intergenic
965604429 3:170484701-170484723 TGTTCTTCTCATGGTGGGGGAGG + Intronic
966734157 3:183175725-183175747 TGTTCTTCTCCTGGTGGAGAAGG - Intergenic
967766874 3:193290839-193290861 TTTGCTTCTCAAGGCAGAGCAGG + Intronic
969622880 4:8287527-8287549 ACATCTTCTCATGGCAGAGCCGG + Intronic
971226076 4:24752451-24752473 AGTGGTTCTCATGGGATAGCAGG + Intergenic
972966559 4:44517836-44517858 ATTTCTTCTCAGAGGAGAGCAGG - Intergenic
973213382 4:47641036-47641058 TGGTCTTCACATGGGAGAAATGG + Intronic
974556597 4:63459549-63459571 TGGTCTTACCATGGCAGAGCAGG + Intergenic
975506146 4:75140459-75140481 TTTTTTTCTCATGGGATAGTTGG - Intergenic
976221189 4:82758136-82758158 TGTTCACCTCCTGGGAGAGGGGG + Intronic
976336708 4:83896174-83896196 TCTTCTTCTCAGGGGAGAAGCGG + Intergenic
977242808 4:94593548-94593570 TGTTCTTCTCATGAAAGCTCTGG + Intronic
978645665 4:110928218-110928240 GGCTCTTCTCTTGGGAGAGTGGG - Intergenic
986827547 5:11538235-11538257 TTTTCATCTAATGGGAGAGTGGG + Intronic
988070124 5:26277250-26277272 AGTTCTTCACATGGTGGAGCAGG - Intergenic
990057843 5:51607185-51607207 TGTTTTTCTCATGGGATTACTGG + Intergenic
991042493 5:62190385-62190407 ACTTCTTATCATGGCAGAGCAGG - Intergenic
993552522 5:89291372-89291394 TGATCTTCACATGGGACAGGTGG + Intergenic
994774832 5:104028072-104028094 TGTTCTTGTCAGAGGAGACCAGG + Intergenic
995513333 5:112929515-112929537 TTTTCTTTTCATGTGAGAGAAGG + Intergenic
999068541 5:148717464-148717486 CCTTCTTCACATGGCAGAGCAGG - Intergenic
999068548 5:148717516-148717538 CCTTCTTCACATGGCAGAGCAGG - Intergenic
999883850 5:155898191-155898213 TGATATTCTCCTGGGATAGCAGG - Intronic
1001456401 5:171863927-171863949 TCTCCTTCTCAAAGGAGAGCCGG + Exonic
1002338677 5:178499471-178499493 TGTTTTTCTCATGGTTGAACTGG - Intronic
1004195733 6:13502999-13503021 TCTTTTACTCAGGGGAGAGCTGG - Intergenic
1005331764 6:24757601-24757623 TTTACTTCTCCTGGGACAGCAGG + Intergenic
1007055807 6:38883324-38883346 TGTTTTGCTCACAGGAGAGCAGG + Exonic
1010376032 6:75171631-75171653 TGTTTTTCTCTTGGGAGAGGAGG - Intronic
1010816036 6:80359255-80359277 TGTTCTCCTCGTAGGAGGGCAGG + Intergenic
1011000061 6:82577995-82578017 TGTTCTTCTCATGGTTAAGCTGG - Intergenic
1011382141 6:86753664-86753686 TGTTCTTCTCTGGAGAGAGCAGG - Intergenic
1014187337 6:118450536-118450558 CCTTCTTCACATGGTAGAGCAGG - Intergenic
1015483269 6:133739935-133739957 TGGCCTTCACATGAGAGAGCTGG - Intergenic
1017620700 6:156293701-156293723 ACTTCTTCACATGGCAGAGCAGG + Intergenic
1018243500 6:161801038-161801060 TGTTGTTGTCATGGGAGGGGTGG - Intronic
1019995449 7:4721516-4721538 AGCTCTTATCATTGGAGAGCTGG - Intronic
1020747769 7:12099448-12099470 CCTTCTTCACATGGCAGAGCGGG - Intergenic
1021059062 7:16086916-16086938 TGTTCTTCTCATGGTGGTGGGGG + Intergenic
1021914129 7:25414643-25414665 TGTTCATCTCATGGGAGAATGGG - Intergenic
1022043954 7:26608437-26608459 TGGTATTCTCATGGGAGGGGAGG + Intergenic
1022788909 7:33666998-33667020 TGTTCATCTCTAGGGAGAGAGGG + Intergenic
1022844081 7:34192412-34192434 TGATCTGCTCATGGGAGAGAAGG - Intergenic
1023721875 7:43104247-43104269 TGTTTTTCTCAGGGGAAAGAGGG - Intergenic
1023731819 7:43198850-43198872 TGTTCTTCTCCCAGGAGAACTGG + Intronic
1026151378 7:67790662-67790684 TGTGCTTTTCTTGGGGGAGCTGG + Intergenic
1028905370 7:96148358-96148380 TGTTCTTCTCATGGACCTGCAGG - Intronic
1030364642 7:108631350-108631372 TTTTTTTCTCATGGGACACCAGG - Intergenic
1031662602 7:124444839-124444861 TGTTCTTCTCCTGGGGGTGGAGG - Intergenic
1035436826 7:158865666-158865688 TGTTCCACTCCTGGGAGTGCTGG + Intronic
1041616668 8:59915391-59915413 TTCTCATCTCTTGGGAGAGCAGG + Intergenic
1045543619 8:103109025-103109047 AGTTCTTCTCCCGGGAAAGCCGG + Intergenic
1045778488 8:105835301-105835323 TTTTCTTCACATGGCAGAGTGGG - Intergenic
1047403569 8:124566432-124566454 TTTTCGTCTCCTTGGAGAGCTGG - Intronic
1049050483 8:140190996-140191018 CGTTCTTCTCATTTGAGAACAGG - Intronic
1052002432 9:23302120-23302142 TCTTCTTCACATGGCAGAGCAGG + Intergenic
1053302541 9:36962145-36962167 TGTTCTTCCCATGGGAGACAGGG + Intronic
1055146547 9:72942254-72942276 TTTTCTTCTCAAGGGATGGCTGG + Intronic
1058657003 9:107231855-107231877 TGTGCTCCTCATGGGTGAGGTGG - Intergenic
1060730550 9:126034173-126034195 TGTGCCTCTGATGGGAGACCTGG - Intergenic
1060791052 9:126485912-126485934 TGTTCCTCTCGGAGGAGAGCTGG - Intronic
1060973311 9:127751282-127751304 TGTACTTCTCCTTGGAGAACTGG + Exonic
1187746281 X:22412772-22412794 TGTTCTTCGCATTAGAGAGTAGG + Intergenic
1188384515 X:29539700-29539722 GGTACTTCACATGGCAGAGCAGG - Intronic
1190372859 X:49759558-49759580 CCTTCTTCACATGGCAGAGCAGG + Intergenic
1191953810 X:66622932-66622954 TATTCTCCTGATGGCAGAGCTGG - Intronic
1192623381 X:72702672-72702694 TGTCCTACTCATGAGAGATCAGG + Intronic
1193463133 X:81813634-81813656 GGATCTTCACATGGCAGAGCAGG - Intergenic
1194409948 X:93544980-93545002 TCATCTTCACATGGCAGAGCAGG + Intergenic
1195964273 X:110416157-110416179 TATTGTTCTCATGGTAGAGATGG + Intronic
1196898607 X:120361790-120361812 TGTTCTTCTCAATTGAGAGTTGG - Intergenic
1200976382 Y:9216006-9216028 TGTTCTTCACATGGGGGTGCTGG + Intergenic
1202134788 Y:21650524-21650546 TGTTCTTCACATGGGGGTGCTGG - Intergenic