ID: 1162337519

View in Genome Browser
Species Human (GRCh38)
Location 19:10071014-10071036
Sequence TCGGGTTCACAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162337513_1162337519 4 Left 1162337513 19:10070987-10071009 CCATGAGAAGAACACGGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1162337512_1162337519 5 Left 1162337512 19:10070986-10071008 CCCATGAGAAGAACACGGTGCTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1162337510_1162337519 13 Left 1162337510 19:10070978-10071000 CCAGCTCTCCCATGAGAAGAACA 0: 1
1: 0
2: 1
3: 17
4: 190
Right 1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162337519 Original CRISPR TCGGGTTCACAGGATGCTGC AGG Intergenic
901323737 1:8355226-8355248 TCAGCTACACAGGAGGCTGCGGG - Intronic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
902137636 1:14324044-14324066 TAGGGTGCACAGGTTGCTGTGGG - Intergenic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
904303531 1:29571791-29571813 TCTGCTTCATAGGATGCTGTGGG + Intergenic
906521799 1:46471194-46471216 TCAGGTTCTAAGGATGCTGTAGG + Intergenic
907265564 1:53258224-53258246 TCTGGGACACAGTATGCTGCTGG - Intronic
907305540 1:53511002-53511024 CCTGGACCACAGGATGCTGCAGG + Intronic
916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG + Intergenic
918611565 1:186498212-186498234 TAGGGTTCACAAGAGGCTCCTGG - Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
920732942 1:208505087-208505109 CCGGGTTCAAGGGATTCTGCTGG + Intergenic
921516767 1:216102704-216102726 TCGGGTTCACACCATTCTCCTGG - Intronic
1063070704 10:2660370-2660392 TCGAGGTCGCAGGGTGCTGCAGG - Intergenic
1063242770 10:4188314-4188336 CGGGGTTCACAGGATGCTTTGGG - Intergenic
1070269424 10:74938402-74938424 CCTGGTTCACATGATACTGCTGG - Intronic
1076482645 10:130794859-130794881 GCAGGTGCACAGGATGGTGCAGG + Intergenic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1091936824 12:4441461-4441483 TCGGATTCACAGGCTGCAGAGGG - Intronic
1094012670 12:25825675-25825697 AGGGTTTCACAGGATGTTGCTGG - Intergenic
1094493222 12:30974241-30974263 TCAGGTTCTCAGGCTGATGCTGG - Intronic
1096180444 12:49547781-49547803 TTGGGGTCACAGGATGCAGTTGG - Intronic
1096513695 12:52145313-52145335 TCTGCTTCCCAGGAAGCTGCTGG - Intergenic
1097073848 12:56377402-56377424 TAGGTTTCACAGGATGCAGCAGG + Intergenic
1101285341 12:103306192-103306214 TCAGTTTCACTGGATGGTGCTGG + Exonic
1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG + Intronic
1107084067 13:36406629-36406651 TAGGGTTTCCTGGATGCTGCAGG + Intergenic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1108442297 13:50467153-50467175 TGTGGTTCACAGGATGATGAGGG - Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1120128770 14:80780414-80780436 TTGGTTTCACAGGAAACTGCTGG + Intronic
1121518079 14:94567043-94567065 CCGGGTGCCCATGATGCTGCAGG + Exonic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1124349916 15:28947650-28947672 TCTGGTTCCCAGGAGGCTGTGGG - Intronic
1125253399 15:37732899-37732921 TCTGGTTCCCAGGATGCAGTGGG + Intergenic
1132461762 16:58912-58934 ACAGGTTCACAGCAGGCTGCAGG + Intronic
1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG + Intergenic
1132805626 16:1773792-1773814 TCGGGTCCACCGCAGGCTGCGGG - Exonic
1133713752 16:8427365-8427387 ACGTGTTCACAGGTTTCTGCAGG - Intergenic
1137670286 16:50274557-50274579 TCGGGTTCTCAGGAAGCCTCGGG + Intronic
1138580994 16:57940311-57940333 CCCGGGTCACAGGGTGCTGCTGG - Exonic
1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG + Intronic
1142099934 16:88265691-88265713 CCTGGGTCACAGGGTGCTGCAGG + Intergenic
1142133889 16:88442952-88442974 TGGGGTGCCCTGGATGCTGCCGG - Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1153588077 18:6644572-6644594 TTGGTTTCACAGGATACTGATGG - Intergenic
1158014052 18:52763419-52763441 TGGGATTCAAAGGATGCTCCTGG - Intronic
1160735167 19:659042-659064 CCATGTTCACAGGGTGCTGCAGG + Intronic
1160896128 19:1402689-1402711 TGAGGTTCACAGGTTGCAGCAGG + Intergenic
1161932241 19:7348862-7348884 TTGGTTCCACAGGAAGCTGCTGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1164034281 19:21439354-21439376 TCTGGTTCCCAGGGGGCTGCTGG + Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
927206635 2:20615304-20615326 GCTGCTTCACAGGATGCTGTGGG + Intronic
932047048 2:68360177-68360199 TCTGGTACGCAGGATGCTTCAGG + Intergenic
934763982 2:96870185-96870207 GCGGGTCCACAGGTCGCTGCGGG - Intronic
936958560 2:118048706-118048728 TCTGATTGACAGGATGCTGTGGG + Intergenic
938930877 2:136086071-136086093 TGGGGATCACAGGATAATGCAGG + Intergenic
946865828 2:224039902-224039924 CTGGGTTCCCAGGACGCTGCGGG - Intergenic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1173190205 20:40870144-40870166 GTGGGTTCACAGGTTGATGCAGG - Intergenic
1173690097 20:44954004-44954026 TCGGTTTCACATGGTGCTGCAGG - Intronic
1177231708 21:18330195-18330217 TGGGGTTCAAAGGATGTTGGAGG - Intronic
1181360433 22:22330108-22330130 TCGGGTTCATTTGATGCTGGAGG + Intergenic
1181426796 22:22849002-22849024 TCAGCTCCCCAGGATGCTGCTGG - Intronic
1181735212 22:24876241-24876263 TCATGCTCACAGGATGCTGCAGG - Intronic
1185013453 22:48329794-48329816 TCAGGCTCACATGTTGCTGCTGG - Intergenic
950968243 3:17161441-17161463 AGGGGCTCACAAGATGCTGCTGG - Intronic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962909943 3:139838796-139838818 TCAGTTACACAGCATGCTGCTGG - Intergenic
963312478 3:143723795-143723817 TCAGGTAACCAGGATGCTGCTGG - Intronic
965603806 3:170480415-170480437 TGGGGTTCTCTGGCTGCTGCAGG + Exonic
968315102 3:197717348-197717370 CCGGGTTCACAGCATTCTCCTGG - Intronic
968603168 4:1520018-1520040 TCGGGGTCACCCGCTGCTGCGGG + Intergenic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
983401185 4:167268279-167268301 TCTGGGTCACAGGATGATGTAGG + Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1003183874 6:3813949-3813971 GCGGGCTCCCAGGATGCAGCAGG + Intergenic
1006258711 6:32851250-32851272 TGGGGTTCTAAGGAGGCTGCAGG + Intronic
1012932587 6:105332243-105332265 TCGGGGTCACAGGTTGCTATGGG - Intronic
1020353714 7:7253741-7253763 ACGGGTCCACATGAGGCTGCTGG - Intergenic
1024417316 7:49121835-49121857 TTGGGGTCACAGGATGCTTTTGG - Intergenic
1033262853 7:139858603-139858625 TCCGGGTACCAGGATGCTGCAGG - Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034675228 7:152888069-152888091 TCGAGTTCACAGGTGGCTGCAGG - Intergenic
1039948981 8:42153170-42153192 GCGGGGTCTCAGGATGCAGCCGG + Intronic
1044327149 8:90871709-90871731 TCTGGTTCATGGGATGCTGTAGG - Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049494932 8:142925450-142925472 TCGGGTTCACATGAAGATGAGGG + Intergenic
1051595542 9:18821321-18821343 GCAGGGTCACAGGATGCTGGTGG + Intronic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1058137711 9:101325781-101325803 TCTGGTTTAAGGGATGCTGCTGG + Intergenic
1059247866 9:112863706-112863728 TGGGGTTCAGAGGAGGCAGCTGG + Intronic
1062031138 9:134362524-134362546 TCGTGGTCACAGCATGGTGCTGG + Intronic
1062516740 9:136940675-136940697 TGGGGTACACAGGATACTGGGGG - Exonic
1188274106 X:28178696-28178718 TTGGGTCCACAGGCTGCTCCTGG + Intergenic
1190063516 X:47225424-47225446 TCGATTTCACGCGATGCTGCAGG + Intronic
1192502173 X:71661390-71661412 TCGGGCTCTCAGAATGCTGGAGG - Intergenic
1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG + Intergenic