ID: 1162341653

View in Genome Browser
Species Human (GRCh38)
Location 19:10094890-10094912
Sequence TGTGGTTCCGGTCCGTCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162341653_1162341659 -9 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341659 19:10094904-10094926 GGAACCACAGGCACCAGTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 217
1162341653_1162341658 -10 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341658 19:10094903-10094925 CGGAACCACAGGCACCAGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 117
1162341653_1162341667 9 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341667 19:10094922-10094944 GGGGGTGGCGGCAGGACCTGGGG 0: 1
1: 1
2: 8
3: 82
4: 642
1162341653_1162341666 8 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341666 19:10094921-10094943 TGGGGGTGGCGGCAGGACCTGGG 0: 1
1: 1
2: 10
3: 55
4: 422
1162341653_1162341670 26 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341670 19:10094939-10094961 CTGGGGTGACGGAGAAAGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 209
1162341653_1162341662 -3 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341662 19:10094910-10094932 ACAGGCACCAGTGGGGGTGGCGG 0: 1
1: 0
2: 4
3: 48
4: 512
1162341653_1162341665 7 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341665 19:10094920-10094942 GTGGGGGTGGCGGCAGGACCTGG 0: 1
1: 1
2: 7
3: 93
4: 731
1162341653_1162341668 15 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341668 19:10094928-10094950 GGCGGCAGGACCTGGGGTGACGG 0: 1
1: 0
2: 1
3: 49
4: 410
1162341653_1162341663 1 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341663 19:10094914-10094936 GCACCAGTGGGGGTGGCGGCAGG 0: 1
1: 0
2: 2
3: 50
4: 482
1162341653_1162341660 -6 Left 1162341653 19:10094890-10094912 CCACAAGACGGACCGGAACCACA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162341660 19:10094907-10094929 ACCACAGGCACCAGTGGGGGTGG 0: 1
1: 0
2: 3
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162341653 Original CRISPR TGTGGTTCCGGTCCGTCTTG TGG (reversed) Exonic