ID: 1162341753

View in Genome Browser
Species Human (GRCh38)
Location 19:10095429-10095451
Sequence AATAAAGTGCAGACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162341750_1162341753 22 Left 1162341750 19:10095384-10095406 CCTGGGAGACAGAGCGAGACTCC 0: 1174
1: 36576
2: 92192
3: 135105
4: 144290
Right 1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 281
1162341749_1162341753 26 Left 1162341749 19:10095380-10095402 CCAGCCTGGGAGACAGAGCGAGA 0: 1856
1: 54896
2: 158184
3: 190413
4: 163615
Right 1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 281
1162341751_1162341753 1 Left 1162341751 19:10095405-10095427 CCATCTCAAAAATAAAATTAAAA 0: 10
1: 538
2: 2296
3: 97566
4: 92031
Right 1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162341753 Original CRISPR AATAAAGTGCAGACAGAGCT GGG Intronic
900744023 1:4348690-4348712 AATATATTGCAGAAAGAGTTGGG - Intergenic
900789310 1:4668815-4668837 AATAAAAGGCAGGCAGAGCCCGG - Intronic
902899826 1:19507317-19507339 AATAAAGTCCACACAGAATTGGG - Intergenic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
903315229 1:22498479-22498501 AAGAAAGAGCAGAGAGAGCAGGG + Intronic
903886564 1:26544256-26544278 TATCAAGTGGAGACAGAGATTGG - Intronic
904002326 1:27345766-27345788 AAAAAAAAGCAGACAGATCTGGG - Intronic
904891978 1:33786166-33786188 AACAGAGTGCAGAAAGATCTGGG - Intronic
905880782 1:41462362-41462384 ATGAAGGTGCAGACAGGGCTTGG + Intergenic
906098804 1:43242598-43242620 CATAAAGTGCAAACAGAAATAGG - Intronic
906226398 1:44125926-44125948 TATGAGGTGCAGACAGAGGTTGG - Intronic
907548743 1:55286223-55286245 AATGAACTAGAGACAGAGCTGGG + Intergenic
907625704 1:56027171-56027193 ACTAAAATGCTGATAGAGCTAGG - Intergenic
909986367 1:82165101-82165123 AATAAAGTGCATTCAGTACTGGG - Intergenic
911751118 1:101499419-101499441 AATAAACTCCAGACACATCTTGG + Intergenic
912300628 1:108512819-108512841 AATAAAGTGCAGTCATAATTTGG + Intergenic
912358966 1:109078766-109078788 AAAAAAGTGCAGCTAGGGCTGGG + Intergenic
912507430 1:110165794-110165816 AATAAAGTAATTACAGAGCTGGG + Intronic
912643194 1:111367087-111367109 AATGAACTGGAGACTGAGCTTGG + Intergenic
912656437 1:111490116-111490138 ACTGAAGGTCAGACAGAGCTGGG + Intronic
913001589 1:114585958-114585980 TATAAAATGTAGTCAGAGCTGGG + Intronic
913288080 1:117245778-117245800 AACAAATTGGAGACACAGCTGGG + Intergenic
915013334 1:152710444-152710466 GAGAAAGTGCAGACTGAGGTGGG + Intergenic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
920291804 1:204928792-204928814 AATAAAGTGCAGCCACTTCTAGG - Intronic
923299003 1:232623212-232623234 AATCACATACAGACAGAGCTAGG + Intergenic
923788614 1:237092031-237092053 AATCAAGACCAGAGAGAGCTAGG - Intronic
924087523 1:240468422-240468444 ACTCAAGTGCAGACACAGTTTGG + Intronic
1063520462 10:6736283-6736305 AATAAAATGCAGAAAGCCCTAGG - Intergenic
1064148184 10:12841802-12841824 AATGAAGTGAAGAAAGAGCGAGG - Intergenic
1064270335 10:13859630-13859652 AATGAAGAGGAGACAGAGATTGG - Intronic
1065361756 10:24895539-24895561 AATAAAGTGAAGACTGGGCGTGG - Intronic
1066073899 10:31852538-31852560 ACTACAGTGCAGACGGATCTCGG - Exonic
1068579912 10:58727768-58727790 AATCAAGTACAGACATACCTTGG + Intronic
1069893912 10:71668630-71668652 AATAAAGTGCAGGAAATGCTTGG + Intronic
1069983038 10:72265674-72265696 AATGAAGTGCAGGGAGGGCTAGG - Intergenic
1070371906 10:75790610-75790632 AAGAAAGTGAAGGCCGAGCTTGG - Intronic
1071164706 10:82791983-82792005 TTTAAAGTTCACACAGAGCTGGG + Intronic
1071424808 10:85538698-85538720 AATAAAGGGCAGACTCAGTTTGG - Intergenic
1074232798 10:111554663-111554685 AATAAGGTGTATACAGGGCTGGG - Intergenic
1075093379 10:119455838-119455860 AAGGAAGAGCAGACAGAGGTGGG - Intronic
1076470499 10:130714869-130714891 AGTGAAGAGCAGGCAGAGCTGGG - Intergenic
1078163513 11:8862878-8862900 ACTCAAATGTAGACAGAGCTGGG + Intronic
1078269463 11:9781460-9781482 AATGATGTGCAGACAGAGCCAGG + Intronic
1078993685 11:16674570-16674592 AATAAAGGGCAGCCAAGGCTGGG + Intronic
1079010657 11:16825563-16825585 AATAAAATACAGACAGTGCTTGG + Intronic
1079198407 11:18352718-18352740 AATAATGTCCAGACAGAATTTGG - Intronic
1080603475 11:33843654-33843676 AATAAAGTGCTGGCAGGGGTCGG - Intergenic
1081043157 11:38236693-38236715 AGTAAAATGCATACAGAGATTGG - Intergenic
1081756170 11:45546265-45546287 AATGAAGTATAGACAGAGCCAGG - Intergenic
1083336982 11:61928266-61928288 AGGAAAGTGCAGCCAAAGCTGGG + Intergenic
1083381318 11:62270877-62270899 AATAAGGGGCAGCCAGAGCCTGG - Exonic
1084465260 11:69319623-69319645 AATAAAAGGGGGACAGAGCTAGG - Intronic
1085700812 11:78744437-78744459 AATAAAGTTCAGACAGGGAATGG + Intronic
1086212708 11:84340302-84340324 AATACAGTGCATGCAGACCTAGG - Intronic
1088173487 11:107022677-107022699 AATAAAGTGTATAGAGACCTGGG - Intergenic
1088250253 11:107856312-107856334 AGGAAAGGGCAGACAGAGCCTGG - Intronic
1088522420 11:110713132-110713154 AGGAAAATGCAGACAGAGCGAGG + Intronic
1088676073 11:112194883-112194905 AATAAAGAGGAGAGAGAGCTGGG - Intronic
1090370215 11:126245531-126245553 AAGAAAGTGAAAACAGAGCCAGG + Intronic
1090381472 11:126330574-126330596 AATAAGGAGCAGGCAGAGCCAGG + Intronic
1091272456 11:134327183-134327205 AACAAAGTGCAGACCGAGAAAGG - Intergenic
1092066877 12:5597751-5597773 AAGAAAGTGCTGCCAGAGATTGG - Intronic
1094545805 12:31403919-31403941 AAAAAAGTGCAGACAGGGCCAGG + Intronic
1096251559 12:50036384-50036406 AATAAAGTGCAGACAGGCAGTGG - Intergenic
1096251830 12:50038384-50038406 AGGAAGGTGCAGACAGGGCTCGG - Intergenic
1096368354 12:51047710-51047732 ATTTAAGTTGAGACAGAGCTTGG + Intergenic
1096901024 12:54882506-54882528 AAAAAAGTGCACATTGAGCTTGG - Intergenic
1096961446 12:55582156-55582178 AATAACCTGCACACAGTGCTTGG - Intergenic
1097258762 12:57700776-57700798 AAAAAAATGCGGACAGGGCTGGG + Intronic
1098721968 12:73911769-73911791 TACTAGGTGCAGACAGAGCTAGG - Intergenic
1099354537 12:81617654-81617676 AATAAAGTGAGGACAGAGAGAGG - Intronic
1101618259 12:106358834-106358856 AATAAACATCTGACAGAGCTTGG + Intronic
1101961904 12:109256976-109256998 ACTAAAGTGCAGCCAGGGCCGGG + Intronic
1102668139 12:114593803-114593825 AATATAGTTTGGACAGAGCTGGG - Intergenic
1102721774 12:115022602-115022624 AAGAAAGTACATTCAGAGCTGGG - Intergenic
1103212008 12:119174129-119174151 CTTAAAGTTCAGACAGACCTGGG + Intergenic
1104125857 12:125845219-125845241 AACAAAGTGCAGAGCGATCTAGG - Intergenic
1106020081 13:25905997-25906019 AAAAAACTGCAGAGAGAGTTGGG - Intronic
1107092271 13:36494765-36494787 AAAAAAGTGCAGTCAGCACTTGG + Intergenic
1107876736 13:44797368-44797390 AACAAACTCCAGACAGAGCAAGG - Intergenic
1108225191 13:48282201-48282223 CATTAAGTGCAGATAGAGGTGGG - Intergenic
1109182444 13:59230086-59230108 ACTAAAGTACAGACAGAACACGG - Intergenic
1110182602 13:72635417-72635439 AAAAAAGGTCAGATAGAGCTTGG - Intergenic
1110617993 13:77562500-77562522 AATGAAGTGCAGTTTGAGCTGGG - Intronic
1112374059 13:98822284-98822306 AATCAAGTGCAGACAGCCTTGGG - Intronic
1112560641 13:100510522-100510544 AATGAAGTGCTGTCTGAGCTGGG + Intronic
1113045026 13:106146419-106146441 CAGAAAGAGCAGAAAGAGCTTGG - Intergenic
1113349443 13:109513863-109513885 AAGAAAGAGAAGACAGATCTGGG - Intergenic
1113414074 13:110114275-110114297 AAATCACTGCAGACAGAGCTCGG + Intergenic
1115923558 14:38405923-38405945 AATGCAGGGCAGACAGGGCTTGG - Intergenic
1116380260 14:44258969-44258991 ATTAAAGTGCAGCCAGAGGAGGG - Intergenic
1118053780 14:62057083-62057105 AATAAAAAGCAGGCAGAACTGGG - Intronic
1118069872 14:62234537-62234559 TATAAAGTGCAGACTGACATGGG - Intergenic
1120572584 14:86140009-86140031 ATTAAAGTATAGAAAGAGCTTGG - Intergenic
1121120450 14:91372698-91372720 GATAACGTGCAGACAGGGCTGGG - Intronic
1125560700 15:40630827-40630849 AATAAAGTTCAGACTGGGCATGG + Intronic
1125660672 15:41392362-41392384 AATAAAGTCCAGGCTGGGCTAGG - Intronic
1127546607 15:59999144-59999166 AATAAAGAGTAGCCAGAGTTAGG - Intergenic
1127730770 15:61800224-61800246 AATAAACTTCAGCCAGTGCTTGG - Intergenic
1128621846 15:69157900-69157922 GAGAAAGTGAAGACAGAGCTTGG + Intergenic
1128692015 15:69731815-69731837 AATGAATTGCTGACAGAGCCAGG - Intergenic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1130571190 15:85045411-85045433 AATTAAATTCAGACAGAACTGGG + Intronic
1130866681 15:87939470-87939492 AATACAGTGCAGGCATAGCATGG - Intronic
1130901301 15:88208665-88208687 ATTAAACTGCAGGAAGAGCTGGG + Intronic
1133308700 16:4828548-4828570 AATAAACTGCAGACAGCCCTTGG - Intronic
1133623163 16:7545594-7545616 AAAGAAGTGGAGACTGAGCTGGG - Intronic
1133652113 16:7822327-7822349 AAGGAAGAGCAGAAAGAGCTGGG - Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135174191 16:20213493-20213515 AATAAATTGCAAACATAACTAGG - Intergenic
1135224453 16:20643369-20643391 AATAAATTCCAGACACAGTTTGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136549172 16:30973252-30973274 AATGCAGTGCAGAGAAAGCTTGG + Intronic
1140837741 16:78810927-78810949 AAAATACTGCAGGCAGAGCTGGG + Intronic
1141322599 16:83025849-83025871 AATCTAATGCAGACAGAGCCAGG - Intronic
1143734304 17:8899680-8899702 AGTTAAGTGGAGAAAGAGCTAGG - Intronic
1144037827 17:11383231-11383253 AAAAAAGGGCTGACAGGGCTGGG - Intronic
1146006757 17:29165471-29165493 ACTAAGGTTCAGGCAGAGCTTGG + Intronic
1148234811 17:45961699-45961721 AATGAAGTGGAAAGAGAGCTGGG + Intronic
1148357233 17:46983587-46983609 AAGAAAGGGCAGACAGGGCCGGG - Intronic
1149771385 17:59324570-59324592 AATAACTTGCACACAGCGCTGGG + Intergenic
1150358899 17:64511699-64511721 ATTAAAGTGAAGACAGGCCTAGG + Intronic
1151074996 17:71261257-71261279 AATAAAGTTTAGACATAACTAGG + Intergenic
1152725771 17:81944973-81944995 AATAAAGTGTTGGCGGAGCTCGG + Intronic
1155148268 18:23101873-23101895 AATACAGTGCAGGCAGAGGCAGG + Intergenic
1155275581 18:24184444-24184466 AATAAAGGGAAGAGAGAGCAGGG - Intronic
1155287056 18:24300357-24300379 AATAAAATGCAGACTTATCTGGG - Intronic
1156706563 18:39889373-39889395 ATTAAAGTGCTGTCAGGGCTGGG + Intergenic
1156715924 18:40010634-40010656 AATTAAGTGCAGAGAGAGAAAGG - Intergenic
1159482583 18:69009279-69009301 AAAATAATGCAGACAGATCTAGG + Intronic
1160344769 18:78123870-78123892 AAGGCAGTGCAGACAGAGTTTGG - Intergenic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
1168185824 19:54698687-54698709 AGTAAAGTGCAGGGAGGGCTGGG + Intronic
925358704 2:3262244-3262266 AATATAGTCCAAACAGACCTGGG + Intronic
926686360 2:15701352-15701374 CAGCAAGTGCAGACAGAGCTGGG - Exonic
928039214 2:27857257-27857279 AATAATGTGCAGACACAGGCTGG + Intronic
928080550 2:28308777-28308799 CATAAAGTCAAGACATAGCTGGG + Intronic
929106261 2:38368793-38368815 AATAAAAAGAAGTCAGAGCTGGG + Intronic
929829484 2:45335471-45335493 CAGAAAGAGAAGACAGAGCTGGG + Intergenic
930174304 2:48285959-48285981 AAAAAAGTGCATACAGAGAATGG - Intergenic
930693809 2:54390980-54391002 AAAAATGTGAAGACACAGCTGGG + Intergenic
931637002 2:64350053-64350075 ACAAAAATGCATACAGAGCTAGG + Intergenic
933205194 2:79499303-79499325 CATAAACTGAAGTCAGAGCTAGG + Intronic
933941588 2:87249510-87249532 AATGAAGGGCAGAGAGAGCCAGG + Intergenic
935119662 2:100172784-100172806 AAGAAAATGCAGACAAACCTTGG + Intergenic
936338636 2:111612081-111612103 AATGAAGGGCAGAGAGAGCCAGG - Intergenic
938180270 2:129176125-129176147 AATAAAGAGGAGACTGAGCAAGG - Intergenic
939620531 2:144413528-144413550 AATAAGGTGGAGAAAGAGATAGG - Intronic
939898123 2:147817453-147817475 AATAAAGGGCAGATTGATCTTGG + Intergenic
940135267 2:150428752-150428774 AATAAAGAGAAGACAGAGTGGGG - Intergenic
940330978 2:152474387-152474409 ATTAAGATGCAGTCAGAGCTGGG + Intronic
940860650 2:158767390-158767412 AAGAAAGTGCAGAGAAAGCAAGG - Intergenic
942045107 2:172095470-172095492 AAGAAAGTGCAGGCAGGTCTTGG - Intergenic
942652582 2:178184085-178184107 AGGAAAGTGTATACAGAGCTTGG + Intergenic
943691114 2:190870543-190870565 AATAAAGTAGAGATACAGCTGGG - Intergenic
944444039 2:199771893-199771915 AACATAGTGTATACAGAGCTTGG - Intronic
946114013 2:217445977-217445999 CAGGAAGAGCAGACAGAGCTGGG + Intronic
946316102 2:218913897-218913919 AAGAAAGTGAAAACAGGGCTGGG - Intergenic
947929975 2:233956420-233956442 ACTAAAGTGCAGTCAGCCCTAGG + Intronic
948475276 2:238214388-238214410 AATAAAAGGAAGACAGGGCTGGG - Intergenic
1170805369 20:19625363-19625385 TATTAAGTGCAGATAGAGTTTGG + Intronic
1171245185 20:23605045-23605067 CATTAAGTGCAGACAGAGCAAGG + Intronic
1172420097 20:34808731-34808753 TCTAAAGTGCAGACAAGGCTGGG - Intronic
1173065776 20:39709579-39709601 CTTAAAGAGCTGACAGAGCTGGG + Intergenic
1173614200 20:44392210-44392232 GATAATGTTCAGACAGTGCTTGG - Intronic
1173813531 20:45970963-45970985 TACAGAGTGCAGACAGAGCCAGG - Intronic
1174158621 20:48534377-48534399 GATAAAGTGCAGACAGAAATTGG + Intergenic
1175656890 20:60778873-60778895 TCTAAAGTGGAGGCAGAGCTTGG + Intergenic
1176197350 20:63843634-63843656 GAGAAAGTGCAGGCAGGGCTGGG - Intergenic
1178542711 21:33468077-33468099 AAAAAAGTGCGGACAGAGAGTGG + Intronic
1179199867 21:39206695-39206717 AACAGATTGCAGACAGAGATGGG - Intronic
1180149300 21:45939624-45939646 AAGAAGGTGCAGACACCGCTGGG + Intronic
1180927036 22:19562510-19562532 AATAAAATACAGACTCAGCTGGG - Intergenic
1181856473 22:25784855-25784877 CATAAAGTGCAGACTGAGGCCGG + Intronic
1182551156 22:31101317-31101339 AAAAAAGTGCAAACTAAGCTGGG + Intronic
1182701808 22:32246224-32246246 AATAATATGCAGTCAGTGCTGGG + Intronic
1183088657 22:35505724-35505746 AATAGAGAGGAGAGAGAGCTGGG + Intergenic
1184218355 22:43082416-43082438 AATAAAGGCCAGACAGGGCGTGG + Intronic
1184333992 22:43842548-43842570 AATGAACTGCAGACATAGCACGG + Intronic
949775425 3:7627138-7627160 AATAAAATGCAAACAGAGATTGG + Intronic
949977186 3:9471590-9471612 AGGAAAGTGCAGAGAGTGCTGGG + Intronic
950078715 3:10206087-10206109 AAGAAAATGCAGAGGGAGCTGGG + Intronic
952492133 3:33882809-33882831 AATAAAGTGTAGAGAGGACTGGG - Intergenic
952687584 3:36167821-36167843 CAGAAAGTGTAAACAGAGCTTGG - Intergenic
953809936 3:46103644-46103666 AATAAAGAGCACACAGGGCCAGG - Intergenic
953928715 3:46995555-46995577 CATAGGGTGCAGACAGAGCCAGG - Exonic
954433096 3:50481703-50481725 AATAAAGTGCAGGCTGGGCATGG + Intronic
955330986 3:58046942-58046964 AATAAAGTACAGACATAACATGG - Intronic
955602372 3:60660248-60660270 ACAAAGGTGCAGACAGAGCCAGG - Intronic
956612616 3:71139729-71139751 AACCAAGTGGAGACAGGGCTGGG + Intronic
957234512 3:77568345-77568367 AGGCAAGTGCAGAAAGAGCTAGG + Exonic
957529269 3:81420102-81420124 AATAAAATCCAGTCATAGCTGGG + Intergenic
957665706 3:83222938-83222960 AATAAACTACAGAAAGAGTTTGG + Intergenic
959088548 3:101877607-101877629 AATAGAGTGGAGGCAGAGCCGGG + Intergenic
959803821 3:110527463-110527485 AAAACAGTGCATACCGAGCTTGG + Intergenic
959914593 3:111802323-111802345 AATAAAGGGGAGACAGAGCAAGG + Intronic
960619995 3:119628233-119628255 CATGAAGCGCAGACAGAGTTGGG - Intronic
960767798 3:121156483-121156505 AATAAAGTACATACAGAACTTGG - Intronic
965616290 3:170596212-170596234 AATGAAGGGTACACAGAGCTAGG + Intronic
965727234 3:171730932-171730954 TAAAAAGTGGAGACAGGGCTGGG - Intronic
966053230 3:175648280-175648302 CATAAAGTGCAGACATAACAGGG + Intronic
967249724 3:187524611-187524633 AATAAAGTGTATAAAGTGCTGGG - Intergenic
967277104 3:187786816-187786838 AAGAAAGAGCAGACAGAGGCAGG - Intergenic
968351958 3:198065086-198065108 AAAAAAGAGCAGACAGAGAAGGG + Intergenic
969847616 4:9931630-9931652 AAGAAAGATCAGACAGATCTAGG - Intronic
970056034 4:11972851-11972873 AGTATAGTACAGACAGATCTTGG - Intergenic
970709747 4:18848109-18848131 AATAAAGTGGACACATATCTAGG - Intergenic
970798811 4:19947574-19947596 ACCGCAGTGCAGACAGAGCTGGG + Intergenic
970885158 4:20979691-20979713 AAGAAAGTGCAAGCAGAGCCAGG - Intronic
971253654 4:24994290-24994312 CATAACTTGCAGACAGAGTTAGG + Intergenic
972952929 4:44351098-44351120 AAGAATGTGAAGACAGAGCACGG - Intronic
973310704 4:48706713-48706735 AATAAGTTACAGAAAGAGCTTGG + Intronic
974843310 4:67322792-67322814 AATAAAGTCCAGGCTGAGGTGGG + Intergenic
976013238 4:80517877-80517899 CATAAAGTGGAGACACAGGTAGG + Intronic
976112591 4:81691820-81691842 AATACAGTGCAGAAAGAACCAGG - Intronic
976130799 4:81881997-81882019 AACTAGGTGGAGACAGAGCTGGG - Intronic
977440953 4:97066748-97066770 AAAAAAGTGAAGTCACAGCTAGG + Intergenic
978435347 4:108678066-108678088 AAAATAGTGCAGACAGTGCTGGG - Intergenic
978915904 4:114125750-114125772 TATAAAGTGCAGACGAAACTGGG - Intergenic
981119163 4:141029077-141029099 ATTAAAATGCAGCCAGATCTTGG - Intronic
981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG + Intergenic
982540502 4:156664112-156664134 TAAAAAGTACAGACAGAGCAAGG + Intergenic
982586375 4:157245761-157245783 AATAAAATTCAGACAGACATAGG - Intronic
982964855 4:161893147-161893169 ATCTAAGAGCAGACAGAGCTTGG + Intronic
983095310 4:163554409-163554431 AATGGAGAGCAGAGAGAGCTGGG + Intronic
987262188 5:16215004-16215026 AAAAAAGTGTAGACAGTGTTTGG - Intergenic
988924212 5:35972838-35972860 ATTAATGTGGAGACAGAGCTTGG - Intronic
989872426 5:46624074-46624096 AATAAAAACTAGACAGAGCTGGG + Intergenic
993277967 5:85886665-85886687 AATAAAGTACAGAAATAGCTTGG - Intergenic
993669671 5:90745065-90745087 AGTAAAGAGCAGACATATCTTGG - Exonic
994085568 5:95754413-95754435 AATACAGTGCAGGGAGAGCCTGG + Intronic
995298246 5:110544885-110544907 CATAAAGTGCAGACAAAGATAGG - Intronic
998638825 5:143986603-143986625 AATAATGGGCAGAGTGAGCTGGG + Intergenic
1001378450 5:171285099-171285121 AAGACACTGGAGACAGAGCTTGG - Intronic
1001749848 5:174120556-174120578 AATGAAGTGCAGGCAGGCCTTGG + Intronic
1002332182 5:178450850-178450872 CATGAACTGCAGACAGAGCCAGG + Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1002527919 5:179825255-179825277 CATAAAGTGCAGGCTGAGTTAGG - Intronic
1002553071 5:180011974-180011996 AATAAACTGCAGTCAGTGTTTGG + Intronic
1007373273 6:41440720-41440742 AACAAAGGGCTGACTGAGCTGGG - Intergenic
1008600605 6:53090285-53090307 AAGAAAATCCTGACAGAGCTGGG - Intronic
1008681543 6:53877718-53877740 AATAAAGTTCAGGCTGAGGTGGG - Intronic
1009801492 6:68543034-68543056 AACCAAGTGAAGACAGAGTTTGG + Intergenic
1010017442 6:71121687-71121709 ACTCCAATGCAGACAGAGCTGGG - Intergenic
1010051225 6:71506306-71506328 ATCAAAGTGCAGACAGAGGGAGG + Intergenic
1011717186 6:90119289-90119311 AATTAGGTAAAGACAGAGCTGGG - Intronic
1011881803 6:92037435-92037457 TATAACGTGCAGCCAGAGATGGG - Intergenic
1012224011 6:96685032-96685054 AATAAGGTCCAGACTGAGGTAGG + Intergenic
1012503134 6:99912863-99912885 AATAAACTGCCTACAGAGATGGG - Intergenic
1013363110 6:109412862-109412884 AACAAAGTGAAGACATGGCTGGG + Intronic
1014633760 6:123819258-123819280 AATGAAATACAGACAGAGATTGG + Intronic
1015331512 6:131985126-131985148 AAGAAAATGTTGACAGAGCTTGG + Intergenic
1017488990 6:154927657-154927679 AATAAAATGCACACAGAGCCTGG - Intronic
1018113268 6:160557626-160557648 AACAAAGTTTAGACAGCGCTGGG - Intronic
1018326203 6:162672010-162672032 AGTAAAGTGAAGACAGAGAGTGG + Intronic
1018642776 6:165919792-165919814 AATAAAGTTCAGAGAAAGTTGGG - Intronic
1020027163 7:4907296-4907318 AATAAAGGGAAGACAGGCCTTGG + Exonic
1020399808 7:7762673-7762695 AATATAGTGCAGACAGAGACAGG + Intronic
1024275210 7:47671666-47671688 AATAAAGCGCAGCCAGAACTGGG - Intergenic
1026645152 7:72161047-72161069 TGAAAAGGGCAGACAGAGCTGGG + Intronic
1026659328 7:72285536-72285558 AAAAAAGTACAGTAAGAGCTGGG - Intronic
1029216905 7:98957103-98957125 GACAAAGTGCAGACAGTGCCAGG - Intronic
1029459607 7:100687305-100687327 AATCCAGCGCAGCCAGAGCTGGG - Exonic
1029871327 7:103696210-103696232 AATAAAATACAAACACAGCTTGG - Intronic
1030179553 7:106691077-106691099 CATAATGTTCAGACAGAACTTGG + Intergenic
1030758223 7:113316462-113316484 AATGAGGTGAAGACAGAGGTGGG + Intergenic
1031263841 7:119557828-119557850 AATAGAGTCCAGACATAGCCAGG - Intergenic
1033130759 7:138743664-138743686 ACCAAAGTGAAGACTGAGCTAGG - Intronic
1034536631 7:151729513-151729535 AGTGGAGTGCGGACAGAGCTGGG - Intronic
1034881325 7:154764767-154764789 AGTAAAGTAGAGACAAAGCTTGG - Intronic
1035301143 7:157897970-157897992 AATGAACTGCACACAGAGCGCGG - Intronic
1038256884 8:25958422-25958444 AATAAAGTGCAGATGGAGAAAGG - Intronic
1040370384 8:46765216-46765238 AGTAAACTGCAGACAGAACTCGG + Intergenic
1042101256 8:65277976-65277998 AATAAAAAGCAGACCGAGCCAGG + Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1042718671 8:71803607-71803629 GATAAAGTACAAACAGAGCATGG - Intergenic
1043154945 8:76767396-76767418 AATAAATCGGAGACACAGCTTGG + Intronic
1046519262 8:115303315-115303337 CAGAAAGTGTGGACAGAGCTTGG - Intergenic
1046573059 8:115991060-115991082 TGTAAAGGGCAGACAGAGATGGG + Intergenic
1048626002 8:136186049-136186071 AATAAAGTCCAAAGAGGGCTTGG - Intergenic
1048687569 8:136920951-136920973 TATAAAGTGAAGACAGGGGTGGG - Intergenic
1050891625 9:10831401-10831423 AATAAAATGGAAACAAAGCTAGG + Intergenic
1052169240 9:25373708-25373730 ATTAAAAGGCAAACAGAGCTGGG + Intergenic
1052790417 9:32870304-32870326 AATAAATTGGATAGAGAGCTGGG + Intergenic
1054970767 9:71083450-71083472 AATAAAATGCAGACAGAGGCAGG - Intronic
1056403693 9:86253753-86253775 CATAAAGTGAAGCAAGAGCTGGG - Intronic
1058419140 9:104818131-104818153 ATTAAAGTGCAGAGAGACCCTGG - Intronic
1059061138 9:111036893-111036915 AATCAAGGGCAGAAAGAACTAGG + Intronic
1059861740 9:118471272-118471294 AATAGTGTGCACACAGAGCAGGG + Intergenic
1186124755 X:6401177-6401199 AATAAGGGCCAAACAGAGCTGGG - Intergenic
1186157243 X:6738391-6738413 TCTAAGGTGCAGACAGAGTTGGG - Intergenic
1186855312 X:13620768-13620790 TATCAAGGGTAGACAGAGCTTGG - Intronic
1186890445 X:13954328-13954350 TATAAAGAGAAGACAGACCTGGG + Intergenic
1187955770 X:24517089-24517111 AGTAAAGTGTACACACAGCTGGG - Intronic
1188110454 X:26192184-26192206 AGTAAGGTGCAGCCTGAGCTCGG - Intergenic
1189390889 X:40575665-40575687 CATAAAGTACAGACAGGGCCGGG + Intergenic
1189576445 X:42358857-42358879 AGTCAAGTGGAGAGAGAGCTGGG + Intergenic
1190431068 X:50378426-50378448 AGTAAAGTGCTGACTGAGGTTGG - Intronic
1190757228 X:53411756-53411778 AAGAAAGTAGAGACAGAGGTGGG - Exonic
1197007134 X:121515098-121515120 AATAAAGTAAAGACAAATCTTGG - Intergenic
1197751369 X:129966041-129966063 AATAAAGTACACAGTGAGCTTGG + Intergenic
1198597430 X:138251825-138251847 AGTAGAGTTCAGACAGAGCAGGG + Intergenic
1199225966 X:145374688-145374710 AATTATGTTAAGACAGAGCTTGG + Intergenic
1200556243 Y:4639792-4639814 AATAAAGTCCAGGCTGAGGTGGG + Intergenic