ID: 1162342335

View in Genome Browser
Species Human (GRCh38)
Location 19:10098999-10099021
Sequence GATCTAAGCAGAAGAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162342335 Original CRISPR GATCTAAGCAGAAGAGCAGA CGG (reversed) Intronic
903010761 1:20328515-20328537 GATCTAAGAAGAGGAAGAGAGGG + Intronic
903559609 1:24217657-24217679 GGTCTAAGCAGAGGAGGGGAGGG - Intergenic
904365690 1:30009746-30009768 GATGTAAGCAGAAAAGTGGAGGG + Intergenic
905492490 1:38355369-38355391 TATCTGAGCAGAAGATCAGAAGG - Intergenic
906401652 1:45509005-45509027 GCGCTACTCAGAAGAGCAGAAGG + Exonic
908525950 1:64987483-64987505 GATCTGAACAGAAGTGCAAAGGG + Intergenic
910267046 1:85348868-85348890 GATCTACCCAGAATGGCAGAAGG + Intronic
910317787 1:85907085-85907107 GATCTAAGCAGAATTCTAGAAGG + Intronic
911119641 1:94282687-94282709 CCTCTAGGCAGAAGAGAAGAGGG - Intergenic
911722406 1:101205736-101205758 GATTTTAGCAGCAGATCAGAAGG + Intergenic
913396111 1:118374671-118374693 GATCTCAGCGGCAGAGCACAGGG - Intergenic
913605873 1:120465305-120465327 GATCAAAGAAGAAAAGAAGAAGG + Intergenic
914082682 1:144423911-144423933 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914177586 1:145292425-145292447 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914367079 1:146988883-146988905 GATCAAAGAAGAAAAGAAGAAGG + Exonic
914367615 1:146993641-146993663 GATCAAAGAAGAAAAGAAGAAGG + Exonic
914485368 1:148104581-148104603 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914585694 1:149059744-149059766 GATCAAAGAAGAAAAGAAGAAGG - Exonic
914906406 1:151749618-151749640 CAACTGAGCAGAAAAGCAGAGGG + Intergenic
914932323 1:151946154-151946176 TATATAAGCGGAAGAGCAAAAGG - Intergenic
915195588 1:154186934-154186956 GATATAAGCAGTAGAGAAGGAGG - Intronic
915471062 1:156126164-156126186 GAAGGGAGCAGAAGAGCAGAGGG - Intronic
916364485 1:164009100-164009122 AATATATGCAGAAGAACAGAGGG - Intergenic
916749777 1:167713804-167713826 CCTCTGAGCAGAAGAGCAGTAGG + Intergenic
916857360 1:168764096-168764118 GATTTGAGAAGAAAAGCAGAAGG - Intergenic
917635915 1:176936104-176936126 GATTTATCCAGAAGAGCAGATGG - Intronic
917674240 1:177304224-177304246 GTTCTAAGTAGGAAAGCAGAAGG - Intergenic
918694036 1:187520567-187520589 GATTTAGGCAGGAAAGCAGATGG + Intergenic
919984021 1:202660177-202660199 CATCTCACCAGAAAAGCAGAAGG + Intronic
920068735 1:203287588-203287610 GAGCTCAGCAGAAGAGGAAATGG + Intergenic
920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG + Intronic
921306401 1:213801061-213801083 GAGCTAAGGTGAAGTGCAGAGGG + Intergenic
922416359 1:225426948-225426970 GAGCTACGGAGAAGAGCAGAGGG - Intronic
922856737 1:228781473-228781495 GATTTAAGCAGCACAGAAGAGGG + Intergenic
924008244 1:239635986-239636008 AATCTAGGAAGAAGAACAGAAGG + Intronic
1064494836 10:15898453-15898475 AATCTAAGCAGCATATCAGATGG - Intergenic
1064523892 10:16232723-16232745 GGTCTTAGCAGAAGCACAGAAGG - Intergenic
1064817323 10:19280850-19280872 GAGCAAAGCATAAGATCAGAAGG + Intronic
1065338061 10:24675301-24675323 GATCAAAGAAGAAGAGGAGGAGG + Intronic
1065482681 10:26211630-26211652 CCTCTAAGCTGAGGAGCAGAGGG - Intronic
1067077907 10:43198472-43198494 GATCTAAGTAGAGGAGCAAAGGG - Intronic
1068020961 10:51583431-51583453 GGTCTGAGCAATAGAGCAGATGG - Intronic
1070964247 10:80519991-80520013 GATCCAAGCAGAAGAGCTTGGGG + Exonic
1071517926 10:86311371-86311393 GACCTAATCAGGACAGCAGATGG + Intronic
1071704681 10:87984464-87984486 GATCTTAGCAGAAAAGCATCTGG - Intergenic
1072170595 10:92856738-92856760 CAACTAAGCAGAAGACCAAAAGG - Intronic
1072618388 10:97064366-97064388 GAGCTAAGCCGAAGAGCATGAGG + Intronic
1073142513 10:101258161-101258183 AATCTAAGCAGAAGTGCTGCAGG + Intergenic
1074501348 10:114027852-114027874 GATCTAATCAGGAGGGCAGTGGG + Intergenic
1075302132 10:121334285-121334307 GGTGTAAGGAGAAGAGTAGATGG + Intergenic
1080775816 11:35385615-35385637 GATCAAGTCAGAAAAGCAGATGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083427800 11:62597794-62597816 AATCCAAGCAGAAGAAGAGAAGG - Intronic
1087266383 11:96066207-96066229 GATCTAAGCATCAGTGCTGAAGG + Intronic
1087903036 11:103664012-103664034 AAACTAAGCATAAAAGCAGACGG + Intergenic
1087915911 11:103810591-103810613 GATATGAGCAAAAGAGCTGATGG - Intergenic
1088947363 11:114528340-114528362 GATGTAAGCAGTAGTGCAGTTGG - Intronic
1091073434 11:132591056-132591078 AATCTGAGCAGGAGAGAAGACGG - Intronic
1095323160 12:40854787-40854809 GAGCTAATCAGAAGAGCAGATGG + Intronic
1096798165 12:54091436-54091458 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1097078838 12:56414461-56414483 GATCTGAGCAGAACACCACAGGG - Intergenic
1098087392 12:66861496-66861518 TTTCTAAGCAAAAGAGCATAGGG - Intergenic
1098159261 12:67633340-67633362 GAACACAGCTGAAGAGCAGAAGG - Intergenic
1098635517 12:72779940-72779962 GATCAATGCAGAAGTGCAGAAGG + Intergenic
1099852219 12:88115339-88115361 AATCTAAACAGTAAAGCAGATGG + Intronic
1102517217 12:113457796-113457818 AAGCTAGCCAGAAGAGCAGAGGG - Intergenic
1103987387 12:124777059-124777081 GATCTAACTAGGAGAGGAGAGGG - Intronic
1105545717 13:21349224-21349246 CATCAAAGCAGATGTGCAGAGGG - Intergenic
1105702532 13:22943980-22944002 GCTCCAAGCAGTAGAGCAGAGGG - Intergenic
1105855157 13:24365761-24365783 GCTCCAAGCAGTAGAGCAGAGGG - Intergenic
1106181380 13:27372366-27372388 GGTGTAAGCAAAAGAGCACAGGG - Intergenic
1106986272 13:35355338-35355360 TTTCTAAGCATAGGAGCAGAGGG - Intronic
1107284427 13:38774366-38774388 GATCTAGGTAGTAGAGAAGAAGG + Intronic
1107773431 13:43812333-43812355 AATCAAAGCAGAACAGCATATGG - Intergenic
1108497126 13:51036046-51036068 GATGGAAGCAGGAGAGCAGAAGG - Intergenic
1108940132 13:55942695-55942717 GATCTAATCAGAAAACCATAAGG + Intergenic
1109059208 13:57591919-57591941 GCTCTGTGCAGAAGAGCAGGTGG - Intergenic
1110733600 13:78909306-78909328 CATCCAATCAGAATAGCAGATGG + Intergenic
1111698665 13:91658853-91658875 GATCTAAAGATCAGAGCAGAAGG - Intronic
1112956741 13:105069086-105069108 TATCTCAACAGAAGAGAAGAAGG - Intergenic
1115200707 14:30851355-30851377 GATTTACTCAGAAGGGCAGAGGG - Intergenic
1119893109 14:78197778-78197800 GATCTGAGCAGGAGAGGAGAAGG - Intergenic
1120186875 14:81402544-81402566 GGTCTGAGCAAAAGAGCTGAGGG + Intronic
1121431045 14:93888737-93888759 GATGTAGGCACAAGATCAGAGGG - Intergenic
1122313989 14:100815034-100815056 GGTCTAAGCTGTAAAGCAGAGGG + Intergenic
1122844044 14:104481038-104481060 GCTCCAAGCAGTAGAGCAGAGGG - Intronic
1122943379 14:104993578-104993600 GCTCAAGGCAGAAGAGGAGATGG + Intronic
1124058186 15:26261716-26261738 CAGCTAAGCAGAGGAGCGGAAGG + Intergenic
1127408229 15:58676208-58676230 GAGTGAAGCAGAAGAGCACAGGG + Intronic
1127923125 15:63509950-63509972 GGTCTAAGCAGAAGAAATGATGG + Intronic
1128624561 15:69186288-69186310 GATAAAAGGAGAAGAGGAGAAGG + Intronic
1129205788 15:74036313-74036335 GATCTAAGCCCATGAGCACAGGG + Intronic
1130732119 15:86507128-86507150 GATCCAAGGAGAAAATCAGAGGG - Intronic
1134121578 16:11587715-11587737 GCTCCAAGCAGACGGGCAGATGG - Intronic
1134825809 16:17283252-17283274 CAGCTAAACAGAAGAGCATATGG - Intronic
1135658957 16:24277819-24277841 GTTTTAAGCAGAAGAGCAATAGG + Intronic
1135732911 16:24909264-24909286 AATTGAAGCAGAAGTGCAGATGG - Intronic
1136685898 16:31994778-31994800 GATCTGAGCAGGAGAGAGGAGGG - Intergenic
1136786507 16:32938310-32938332 GATCTGAGCAGGAGAGAGGAGGG - Intergenic
1136883261 16:33915484-33915506 GATCTGAGCAGGAGAGAGGAGGG + Intergenic
1137856678 16:51801698-51801720 GAAGTAAGCTGAATAGCAGAAGG + Intergenic
1138001775 16:53288257-53288279 GCTCTAAGAAGTAGAGCAGGTGG - Intronic
1203088743 16_KI270728v1_random:1199977-1199999 GATCTGAGCAGGAGAGAGGAGGG - Intergenic
1144860679 17:18299583-18299605 GATCTAAGCCCAAGAGCAAGTGG - Exonic
1145932901 17:28698693-28698715 GATAAAAGCAGAAGTGCACATGG - Intronic
1146494346 17:33307608-33307630 GGTCTAAGAAGATGAGTAGAAGG - Intronic
1147146854 17:38490442-38490464 GATCTGAGCAGGAGAGAGGAGGG - Exonic
1147999240 17:44378258-44378280 CAGCAAAGCAGAAGAGAAGAGGG + Intronic
1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG + Exonic
1148921163 17:51036058-51036080 AATCTTAGAAGAAGGGCAGAGGG - Intronic
1149334385 17:55620510-55620532 GATCTATGCAGGGCAGCAGAAGG - Intergenic
1150739075 17:67765098-67765120 GATGGATGGAGAAGAGCAGATGG - Intergenic
1151170815 17:72244584-72244606 AATATAAGCAGCAGAGCAGTAGG + Intergenic
1153190571 18:2533342-2533364 CATCTCAGCAGAAAAACAGAGGG + Intergenic
1153273103 18:3342519-3342541 GATCCAAGTAAAAGAGCAGGTGG - Intergenic
1156346261 18:36259756-36259778 GATCTTAGCTGAAGAGATGAAGG - Intronic
1156775910 18:40788492-40788514 GGTAGAAGCAGAAAAGCAGATGG - Intergenic
1159033310 18:63253204-63253226 GCACTTAGCAGATGAGCAGAAGG + Intronic
1159455082 18:68651123-68651145 GATCCAAGCAGACGTGTAGAAGG - Intergenic
1162074874 19:8179367-8179389 TTTCTAAGCTTAAGAGCAGAGGG + Intronic
1162342335 19:10098999-10099021 GATCTAAGCAGAAGAGCAGACGG - Intronic
1167000585 19:46743969-46743991 GATCCCAGCAGATGAGCAGAAGG - Intronic
1168540545 19:57206163-57206185 TGTCCAAGGAGAAGAGCAGAAGG + Intronic
1168545881 19:57249316-57249338 TGTCCAAGGAGAAGAGCAGATGG + Intronic
925563190 2:5220601-5220623 GATAGAAGCAGAAGAGCAAGGGG + Intergenic
925585312 2:5459095-5459117 GAACCAAGCAGGAGAGCACACGG + Intergenic
925790012 2:7475060-7475082 GATGTCAGAAGAAGAGGAGAAGG + Intergenic
926391345 2:12396613-12396635 GAGCAGAGCAGAAGACCAGAAGG - Intergenic
926915446 2:17886837-17886859 GATTTAAGGAGAAGATGAGAGGG - Intronic
926964850 2:18398702-18398724 GATCTAAGCAAGAGATAAGAGGG - Intergenic
928033009 2:27797498-27797520 GAATTCAGCAGCAGAGCAGATGG + Intronic
928884311 2:36130643-36130665 GACATAAGCAGAAGAGCGGCAGG + Intergenic
930856027 2:56019029-56019051 ATTATAAGCAGAAGAGAAGAAGG + Intergenic
931367700 2:61633442-61633464 GACCTAAGAAGACCAGCAGATGG - Intergenic
931858517 2:66329348-66329370 TACCTAAGCAGAAGAGAAAAAGG + Intergenic
933752097 2:85609479-85609501 ATTCTAAGCAGAAGAGCTGATGG + Exonic
937855003 2:126665978-126666000 GATCTGAGCAGAAGGGCAAGGGG - Intronic
937874778 2:126815199-126815221 CATCTAGACAGAAGAGCAGTAGG - Intergenic
938389571 2:130894204-130894226 GAACTAAACAGAAGCACAGAAGG + Intronic
941145636 2:161840984-161841006 TAGCTAGGCAGAAAAGCAGAGGG + Intronic
941340674 2:164299969-164299991 GAGAGTAGCAGAAGAGCAGATGG - Intergenic
942377410 2:175352000-175352022 TATATAAGCAGGAGAGCAGAAGG - Intergenic
942847973 2:180448683-180448705 GATTTAAACAAAAGAGCAAAAGG - Intergenic
944052006 2:195480250-195480272 AATATAAGCAGAAGACAAGAGGG + Intergenic
946071057 2:217034803-217034825 GAAATAAGCAGAAAAGCATAAGG - Intergenic
1169155984 20:3330133-3330155 AATCTAGAGAGAAGAGCAGATGG + Intronic
1171849995 20:30301256-30301278 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1172213581 20:33217772-33217794 GGTCTAAGAAAAAGAGAAGAGGG - Intronic
1172283365 20:33723611-33723633 GTGCTAAGCAGAACAGCTGAAGG + Intergenic
1172789600 20:37493713-37493735 GAGCTAAGCAACAGTGCAGATGG - Intronic
1179783195 21:43715692-43715714 GAGACAAACAGAAGAGCAGAAGG + Intergenic
1180022932 21:45140505-45140527 GACCTCTGCAGAACAGCAGATGG + Intronic
1182252513 22:29012302-29012324 GATCTAAACAGTGAAGCAGAGGG + Intronic
1182369443 22:29800707-29800729 GATGTAAGAAGAAGGGAAGAGGG + Intronic
1182574903 22:31266512-31266534 GTTCTCAGCAGAAGAGGAGGAGG - Intronic
1182585588 22:31342732-31342754 GAACAAAGGAGGAGAGCAGAGGG + Intronic
1184044006 22:41960924-41960946 GATCCAGGTTGAAGAGCAGAGGG - Intergenic
1184923351 22:47620963-47620985 GCTCTAAGCAGAAGAGGTGGGGG + Intergenic
949459729 3:4277490-4277512 GACCTAATAAGAAGAACAGAGGG + Intronic
952036098 3:29203486-29203508 GATTTAGGAAGAACAGCAGATGG + Intergenic
952830645 3:37562025-37562047 GCTGTAAGCAGAAGAGCTGAAGG - Intronic
953831107 3:46298164-46298186 GGCCTAAGCAAAAGCGCAGAGGG + Intergenic
954465390 3:50651471-50651493 GCAGTTAGCAGAAGAGCAGATGG + Intergenic
954713281 3:52515305-52515327 CAGCTGAGCAGAACAGCAGAAGG - Intronic
956115089 3:65910073-65910095 GAACTGAGCCGAACAGCAGAAGG - Intronic
957323134 3:78657963-78657985 CATTTAAATAGAAGAGCAGAGGG - Intronic
958025649 3:88045831-88045853 GATTTAAGCAGAAGGAAAGAAGG + Intergenic
963037307 3:141043087-141043109 GATAGAAAAAGAAGAGCAGATGG + Intergenic
964249716 3:154699131-154699153 GACATAAGCAGAACAGGAGAGGG + Intergenic
965834066 3:172831162-172831184 GTGCTACTCAGAAGAGCAGAAGG - Intergenic
965894919 3:173563927-173563949 AATCTGAGCAGAAGAGTGGAAGG - Intronic
965906067 3:173708295-173708317 GACCTTGGCTGAAGAGCAGAAGG + Intronic
967262040 3:187651826-187651848 GATATAAGCAGCAGAGCAGAAGG - Intergenic
967290079 3:187911087-187911109 GTTCTAAGCAGGATAGGAGATGG - Intergenic
969513152 4:7631276-7631298 GGTCCAAGCAGGAGACCAGATGG + Intronic
970261416 4:14228719-14228741 GATTTAATCTGATGAGCAGATGG + Intergenic
971801653 4:31300744-31300766 GAGTTGAGCAGAAGAGCAGCTGG - Intergenic
972848130 4:43014470-43014492 TATGTAATCAGGAGAGCAGATGG - Intronic
973694928 4:53481519-53481541 CATCCAAGCAGGAGAGAAGAAGG - Intronic
974869166 4:67617731-67617753 GGTCTGAGCAGGAGAGTAGAAGG + Exonic
976080951 4:81354124-81354146 GACCTAAGAAGAAGAGGAAAGGG - Intergenic
977165316 4:93687424-93687446 GTTGTCAGCAGAAGAGAAGAAGG + Intronic
979450430 4:120864272-120864294 GAGCTAAGGAGAAAAGCATAAGG + Intronic
980591632 4:134897045-134897067 GTACTAAGCAGAATAGCACAGGG - Intergenic
982331200 4:154183916-154183938 GAACTAAGCAGAAGAGGGCAAGG + Intergenic
982413541 4:155106222-155106244 GTCCTAATCAGAAGATCAGATGG + Intergenic
982448358 4:155521838-155521860 GTTTTAAGCTTAAGAGCAGAAGG + Intergenic
982529823 4:156525533-156525555 GATCTGAGGAGCAGATCAGAAGG + Intergenic
987011434 5:13770193-13770215 GATCTGATCAGAAAAGCATAGGG + Intronic
988410435 5:30878795-30878817 GCTATAAGCAAAAGGGCAGAGGG - Intergenic
989969239 5:50501804-50501826 GAGAAAAGCAGAAGAGAAGATGG + Intergenic
990215320 5:53525275-53525297 GAACTAAGCAGAAGAGAAAGAGG - Intergenic
992625378 5:78632013-78632035 GACCTAAACAGAAGAGAAAAGGG + Intronic
992876509 5:81060944-81060966 GACATAAGCAGAAGAGGAGAAGG - Intronic
993151378 5:84166786-84166808 GATCTAAGAAGAAAAGGAAAGGG + Intronic
995029275 5:107461554-107461576 GATCTAAGCAAGAGAGAAAAGGG + Intronic
996380277 5:122856167-122856189 GAGCTAAACAAAAGAGCACATGG - Intronic
996505714 5:124265802-124265824 GATATAAGCAAAAAAACAGAAGG + Intergenic
996671407 5:126122142-126122164 GAGCTAAGGAGGAGAGGAGAAGG + Intergenic
997481500 5:134188491-134188513 GATCTAAGAAGGAGAACAGAGGG - Intronic
997724493 5:136109253-136109275 GTTCTGAGCATCAGAGCAGAGGG + Intergenic
998509010 5:142695966-142695988 GTTCACAGCAGAAGAGGAGAGGG + Intronic
998595766 5:143528416-143528438 ATTATAAGAAGAAGAGCAGAAGG + Intergenic
998613380 5:143713316-143713338 AATGTAAGCAGATGACCAGAAGG - Intergenic
999452718 5:151690364-151690386 TATCTAAGGATAAGAGCACATGG + Intergenic
999915197 5:156251338-156251360 GGTCTAGGCAAAAGATCAGAGGG - Intronic
1000987420 5:167876024-167876046 GAGCTAGGCAGCTGAGCAGATGG - Exonic
1001054034 5:168434803-168434825 GAGCTCAGCAGTAGAGCAGTGGG - Intronic
1001305964 5:170573030-170573052 CTGCTAAGCAGCAGAGCAGAGGG + Intronic
1001314241 5:170631487-170631509 GACCCAAGCAGGAGAGCAGGAGG + Intronic
1001742035 5:174061415-174061437 GATGTAAACAAAAGAGCAAATGG - Intronic
1002387167 5:178876850-178876872 CATCTATGGAGAAGACCAGATGG - Intronic
1003750946 6:9055261-9055283 GATCTAAGAAGAAAAACAAATGG + Intergenic
1005667576 6:28073807-28073829 TATCAGAGCAGAAGTGCAGATGG - Intergenic
1006718259 6:36133815-36133837 GATCCAAGAGGATGAGCAGATGG + Intronic
1007615722 6:43178989-43179011 GGCCTGAGCAGAAAAGCAGATGG - Intronic
1008438582 6:51505690-51505712 GATCTATTCAGAAGATCATATGG - Intergenic
1010316034 6:74451837-74451859 GAGATGAACAGAAGAGCAGAAGG + Intergenic
1012022679 6:93945023-93945045 GATTTAATCAGAGGAGCAGTTGG - Intergenic
1013939887 6:115648302-115648324 GATCTGAGCAGAACTGAAGAAGG + Intergenic
1014362865 6:120502303-120502325 GATCTCAGCAGAAAAGCTGGAGG + Intergenic
1015242045 6:131035433-131035455 GAAGGAAGCAGAAGAGGAGATGG - Intronic
1017266499 6:152452054-152452076 GATCTAAGGAAAAGAGGATATGG - Intronic
1017346175 6:153384111-153384133 GGCATAAGCAGAAGAGTAGAGGG - Intergenic
1017741335 6:157409338-157409360 GATCCAACCAGAAGACCTGATGG - Intronic
1018764509 6:166922826-166922848 CATCAAGACAGAAGAGCAGATGG + Intronic
1019815450 7:3196829-3196851 GAGCTAACGAGAAGAGCAAATGG - Intergenic
1020571931 7:9874350-9874372 TATCTAAGCAAAATTGCAGATGG - Intergenic
1020911805 7:14140510-14140532 GATCCAAGCTGAACAGCAGGAGG - Intergenic
1021139911 7:17011568-17011590 GATTTAAGAAGAAGATCAGCTGG - Intergenic
1022533993 7:31084597-31084619 GATATCAGCAGAAGAGAGGAAGG + Intronic
1022841175 7:34165353-34165375 GATGTCAGTGGAAGAGCAGATGG + Intergenic
1023264924 7:38394385-38394407 GAGCTCAGCAGAAGAGAAGTCGG - Intronic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1024430430 7:49282291-49282313 GATCTAAGGAGATGGGCAAATGG + Intergenic
1024635835 7:51289543-51289565 GAGGTAAGCAGGAGAGCAGATGG - Intronic
1027237691 7:76307669-76307691 GAAGAAAGCAGAAGAGCAGAGGG + Intergenic
1029448014 7:100625581-100625603 GATATAAGAAGGAGAGGAGAAGG + Intronic
1030711395 7:112754194-112754216 GCTATAAGCAGATGAGCATAGGG - Intergenic
1031080137 7:117250013-117250035 GATCCTTGAAGAAGAGCAGAGGG + Intergenic
1032565806 7:132941674-132941696 GCTCTTAGCAGAGGAGCAGTTGG - Intronic
1033253776 7:139781533-139781555 GATGAAAGCAGAAAAGCAGCTGG + Intronic
1034043251 7:147901089-147901111 GATTTAGGTAGAAGAGAAGATGG - Intronic
1037008632 8:13812531-13812553 GTTGTAAGCAGAAGAGGAGATGG + Intergenic
1037235925 8:16719566-16719588 GACATAAGCAGAGCAGCAGAGGG + Intergenic
1039797708 8:40929361-40929383 GATCTTAGCAGACCATCAGAAGG - Intergenic
1040541492 8:48361011-48361033 GATCCAAGGAGCAGAGCACAAGG - Intergenic
1041389139 8:57333600-57333622 GATCTACGGAGAGGAGCAGCTGG + Intergenic
1042207096 8:66340286-66340308 GAACTAAGGAAAAGAGAAGAGGG + Intergenic
1043523195 8:81068446-81068468 GATCTCAGCAGAAGAGGGAAAGG + Intronic
1045557428 8:103228105-103228127 AGTCCAAGCAGAAGGGCAGATGG + Exonic
1046461983 8:114551271-114551293 TATCTAAACAACAGAGCAGATGG + Intergenic
1046734194 8:117758667-117758689 GATCATAGGAGAAGAACAGAGGG + Intergenic
1047009114 8:120652084-120652106 CATTTAAACAGAAGAGGAGAAGG + Intronic
1047714579 8:127583849-127583871 GATCAAAGGAGAAAACCAGAAGG + Intergenic
1048863787 8:138743968-138743990 GAACTGAGCAGAAGACCATACGG - Intronic
1050000651 9:1073883-1073905 TCTCTAAGCAAAAGGGCAGAGGG - Intergenic
1053787770 9:41664549-41664571 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054157356 9:61650218-61650240 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054176046 9:61875891-61875913 GAGATAAGCAGAACAGCAGAGGG - Intergenic
1054477130 9:65581223-65581245 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1054661493 9:67704917-67704939 GAGATAAGCAGAACAGCAGAGGG + Intergenic
1055486263 9:76759456-76759478 CAGATGAGCAGAAGAGCAGAGGG + Intronic
1057564910 9:96159183-96159205 GTTCTAAGCTGAAGAGGAAATGG - Intergenic
1058473946 9:105311383-105311405 CATGTAAGCAGAAGACCTGACGG - Intronic
1058871012 9:109201757-109201779 GGTCTCAGTGGAAGAGCAGAGGG + Intronic
1059642929 9:116235119-116235141 GACCTATGCAGAAGAGATGAGGG - Exonic
1059749030 9:117230425-117230447 GTTGTAAGAAGAAGAGGAGATGG - Intronic
1060567151 9:124603100-124603122 GATCCAGGCAGAAGGGAAGAAGG - Intronic
1061096520 9:128460340-128460362 GATCCCAGCAGAAGACCACAAGG - Intronic
1061204123 9:129153188-129153210 GAGCCAAGCAGAGGAGCAGTGGG + Intergenic
1185937843 X:4279171-4279193 GATCTCATCTGCAGAGCAGATGG + Intergenic
1187306685 X:18101434-18101456 GCTCTAGGCAGAAGAGTTGACGG + Intergenic
1187521719 X:20020156-20020178 CATCTAAGCAGAGGAACAAATGG - Intronic
1187809751 X:23162475-23162497 GATCTAAGAAGTAAAACAGAAGG + Intergenic
1188237856 X:27751473-27751495 GTTCTAGGAAGGAGAGCAGATGG + Intergenic
1189867623 X:45347710-45347732 TATCTAAGTAGAAGAGAAAAAGG + Intergenic
1190138478 X:47818975-47818997 GATATGAGCAGAAGAGGATAGGG + Intergenic
1192710610 X:73580820-73580842 GAGCTAAGCAAAATTGCAGAGGG + Intronic
1194303341 X:92213623-92213645 AATCTTAGCAACAGAGCAGATGG + Intronic
1194843365 X:98773185-98773207 AATCAAAGAAGAAAAGCAGAAGG + Intergenic
1195771236 X:108353667-108353689 GATCAAACCAAAAGAGCACAGGG + Intronic
1197001717 X:121447702-121447724 CATCTAAGCAACTGAGCAGATGG - Intergenic
1197768378 X:130073439-130073461 GAGCTAAGCAAAAGAGCAGAGGG + Intronic
1198708476 X:139475804-139475826 GCTCCAAGGAGAAGAGCCGAGGG + Intergenic
1198717853 X:139580548-139580570 AATCTAAACAGAAGAAAAGAAGG - Intergenic
1198838554 X:140831518-140831540 GATCCAAGGACAAGAGAAGATGG + Intergenic
1199988406 X:152969072-152969094 AATCTAAGCAGAAGGTCAGGGGG + Intronic
1202191022 Y:22244482-22244504 GAGAGAAGCAGAAGAGCAAATGG + Intergenic