ID: 1162342995

View in Genome Browser
Species Human (GRCh38)
Location 19:10102965-10102987
Sequence CACACACCACACATAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162342989_1162342995 4 Left 1162342989 19:10102938-10102960 CCAGGCGTGATCCCAGCCCCAGA 0: 1
1: 0
2: 3
3: 18
4: 188
Right 1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 242
1162342987_1162342995 15 Left 1162342987 19:10102927-10102949 CCCTGGGGCAGCCAGGCGTGATC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 242
1162342990_1162342995 -7 Left 1162342990 19:10102949-10102971 CCCAGCCCCAGACACGCACACAC 0: 1
1: 1
2: 8
3: 182
4: 1823
Right 1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 242
1162342991_1162342995 -8 Left 1162342991 19:10102950-10102972 CCAGCCCCAGACACGCACACACC 0: 1
1: 0
2: 6
3: 114
4: 1305
Right 1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 242
1162342988_1162342995 14 Left 1162342988 19:10102928-10102950 CCTGGGGCAGCCAGGCGTGATCC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG 0: 1
1: 0
2: 3
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162342995 Original CRISPR CACACACCACACATAGAAAG AGG Intergenic
901034817 1:6330051-6330073 CACACACCACACACACACACTGG - Intronic
901682264 1:10920135-10920157 CACACACCCCCCACAGCAAGTGG + Intergenic
903735808 1:25529326-25529348 CACACACAACACATATATACAGG - Intergenic
906720922 1:48003940-48003962 CACACACCACACACACACTGGGG + Intergenic
907381469 1:54094337-54094359 AACACACCCCAAATAAAAAGGGG - Intronic
908085999 1:60634690-60634712 AACACTCCAAACATAGGAAGGGG - Intergenic
908313941 1:62914110-62914132 CCAAGATCACACATAGAAAGTGG + Intergenic
910806477 1:91193601-91193623 CTCAGGCCACACATAGACAGAGG + Intergenic
911121127 1:94297761-94297783 CACACACAACTCAGAGGAAGAGG - Intergenic
911278914 1:95899220-95899242 CAAACACAACACATATAAATAGG + Intergenic
913045940 1:115073539-115073561 CACAGTCCCCAAATAGAAAGCGG + Intronic
913495111 1:119421540-119421562 CACACACCACACACAAACATAGG + Intronic
913586479 1:120279652-120279674 GACAGAGCACACATAGAAAATGG - Intergenic
913621707 1:120618718-120618740 GACAGAGCACACATAGAAAATGG + Intergenic
914257424 1:145972070-145972092 CACAGTCCACACATAAGAAGTGG + Intronic
914568490 1:148891514-148891536 GACAGAGCACACATAGAAAATGG - Intronic
914604335 1:149238737-149238759 GACAGAGCACACATAGAAAATGG + Intergenic
915847620 1:159284271-159284293 CCCACACCACACTGGGAAAGGGG + Intergenic
916175906 1:162038122-162038144 CACCCACCTCACACAGGAAGAGG + Intergenic
917333217 1:173903847-173903869 CACAAACCAAAAATAGGAAGAGG + Exonic
917471980 1:175333864-175333886 CACTCACCACACAAGGAATGTGG + Intronic
917623494 1:176822052-176822074 CACTCACCCCACATGCAAAGTGG + Intronic
917736183 1:177922504-177922526 CCAGAACCACACATAGAAAGTGG - Intergenic
918659156 1:187068138-187068160 CACACAACACACATACACAATGG + Intergenic
919565242 1:199176957-199176979 CACGCACCACAAAGAGAAAAGGG + Intergenic
923676614 1:236086094-236086116 CACACACCACACATGCACACAGG - Intergenic
924849175 1:247807861-247807883 CACCCACCAGGGATAGAAAGAGG - Intergenic
1062830024 10:599238-599260 AATCCACCACACACAGAAAGTGG + Intronic
1065460807 10:25962026-25962048 CACACACCAGGCTTAGAATGAGG - Intronic
1065774429 10:29106314-29106336 AACACAACACACACAGGAAGAGG - Intergenic
1065954974 10:30685428-30685450 CACACACCACACACATACACAGG - Intergenic
1066185162 10:33003351-33003373 CACACACACCACACAGACAGTGG - Intronic
1069347558 10:67487788-67487810 CACACACCTCACCAAGACAGTGG + Intronic
1070399490 10:76040761-76040783 CACACACCCCAAAAGGAAAGTGG - Intronic
1070739802 10:78895391-78895413 AACACTCCATAAATAGAAAGGGG + Intergenic
1072803070 10:98406955-98406977 CACTCACCACTCAGAGAAAAGGG - Intronic
1073826649 10:107331472-107331494 CACAAACCACACTTAAAGAGTGG + Intergenic
1074900753 10:117814752-117814774 CACAGAACCCACAGAGAAAGTGG - Intergenic
1074901154 10:117817391-117817413 CACAGAACCCACAGAGAAAGTGG - Intergenic
1076151879 10:128169071-128169093 CACACACCTCACATATGGAGGGG - Intergenic
1076486637 10:130824134-130824156 CACACAACACACATATACACAGG + Intergenic
1076745968 10:132514640-132514662 CACACACCACACATCCATACAGG - Intergenic
1077434799 11:2533818-2533840 CAAACTCCACACAAAGAGAGAGG + Intronic
1077714067 11:4564022-4564044 CACACACCACACACAGCTGGAGG + Intergenic
1077773644 11:5248153-5248175 CACACACCACAAACACAAACAGG + Exonic
1080605853 11:33864480-33864502 CGGACACCACCTATAGAAAGAGG - Intronic
1080643071 11:34169261-34169283 CGCACTCCAGACATATAAAGAGG + Intronic
1081661805 11:44892998-44893020 CACACAGCACAGCTAGAACGAGG - Intronic
1082882969 11:58056429-58056451 CACACATCACACAGAAAAACAGG - Intronic
1084183750 11:67459476-67459498 CACTGACCAGTCATAGAAAGTGG + Exonic
1084849908 11:71930296-71930318 CACACCCAACACACAGCAAGGGG - Intronic
1086941808 11:92806036-92806058 CACACACCACACATTGACCATGG - Intronic
1087826504 11:102770291-102770313 TACACACCTAACAAAGAAAGAGG - Intergenic
1088041447 11:105389054-105389076 CACAAACCACAAATAAAAAATGG + Intergenic
1088169950 11:106984743-106984765 CAAACACCATACTTGGAAAGCGG + Intronic
1088571829 11:111230288-111230310 CCCAGACCACTCAGAGAAAGAGG + Intergenic
1088843189 11:113643801-113643823 CACACAGCACACACATACAGTGG - Intergenic
1088936829 11:114410402-114410424 CACACAACATAATTAGAAAGTGG - Intronic
1090522783 11:127496800-127496822 CACACACAACTCACCGAAAGGGG + Intergenic
1091330968 11:134730565-134730587 CACCCAGCACACCTGGAAAGAGG - Intergenic
1093354525 12:18149957-18149979 CACATAGTACATATAGAAAGGGG + Intronic
1093573413 12:20695726-20695748 CACACACCACAGACTGAAAGAGG - Exonic
1093713422 12:22353908-22353930 CCCACACCACAAATACACAGTGG - Intronic
1094452526 12:30597766-30597788 CAGACACATCACATAGCAAGAGG + Intergenic
1095222821 12:39638004-39638026 GATACACCACACATAAACAGGGG - Intronic
1096296514 12:50388705-50388727 CACAGACCTCACCTAGGAAGGGG + Intronic
1096569288 12:52511665-52511687 CACACACCACACACTCCAAGAGG - Intergenic
1098220448 12:68264734-68264756 CACACACCGCCCACAGAGAGAGG + Intergenic
1098888045 12:75980203-75980225 CATCAAGCACACATAGAAAGGGG + Intergenic
1099011160 12:77292738-77292760 TAGACACCACACATATACAGTGG - Intergenic
1099317117 12:81097999-81098021 CAAACAACACACACAGACAGTGG - Intronic
1101277716 12:103220633-103220655 GACAAAACACACACAGAAAGAGG + Intergenic
1101805147 12:108057061-108057083 CACAGACAACACACAGAAGGAGG - Intergenic
1103279486 12:119744171-119744193 AACAAACCAAACAGAGAAAGTGG + Intronic
1105853531 13:24357420-24357442 CACACACCACACACACAAATCGG + Intergenic
1106867073 13:33976815-33976837 CACAGCCCACACTTAAAAAGTGG - Intergenic
1107890675 13:44911524-44911546 CACACACTCCACATGGAAAGAGG + Intergenic
1108447547 13:50525060-50525082 AAAACACCACAAATAAAAAGAGG - Intronic
1108685136 13:52813013-52813035 CACACAACACACACACGAAGAGG + Intergenic
1111131642 13:83984308-83984330 CACACAATACACATTTAAAGTGG + Intergenic
1112524459 13:100131169-100131191 CACAGACCTCACAGAGAATGAGG - Intronic
1113886334 13:113660535-113660557 CACTCATCACACAAAGAACGAGG + Intergenic
1115085011 14:29504886-29504908 CACACACCACACACACACACAGG - Intergenic
1115405194 14:33007161-33007183 TACAATCCACACTTAGAAAGGGG - Intronic
1115935858 14:38551527-38551549 CACAAACAACACATAGACTGGGG + Intergenic
1117432502 14:55682308-55682330 CACTCCCCACAAATGGAAAGCGG - Intronic
1119736105 14:76983493-76983515 CACACACTGTACATATAAAGAGG + Intergenic
1120079267 14:80197260-80197282 CACACAGAATTCATAGAAAGGGG - Intergenic
1120369680 14:83617318-83617340 CACACAACAAGCATAGAAGGAGG + Intergenic
1120695437 14:87639310-87639332 CACACCACACACATAGAAAAGGG + Intergenic
1121442119 14:93955971-93955993 CACCCACCACACCAAGGAAGTGG + Intronic
1124058349 15:26263143-26263165 GACACACCACAGACAGAAAAAGG - Intergenic
1124090385 15:26594252-26594274 CACAAAGCATACAAAGAAAGAGG - Intronic
1127391148 15:58506065-58506087 CACACACCACAGAGACAGAGTGG - Intronic
1127925815 15:63539942-63539964 CACACACTCCACACAGAAATAGG - Intronic
1128073514 15:64811947-64811969 CACACCCAGCACATGGAAAGGGG - Intergenic
1129829470 15:78659086-78659108 CCCCCACCACCCATAGAATGAGG - Intronic
1131729549 15:95265225-95265247 CACCTACCACACAGTGAAAGAGG - Intergenic
1134437035 16:14269110-14269132 CACACACAACACACACAAACAGG + Intergenic
1135952173 16:26924750-26924772 CACAAAGCATACAAAGAAAGAGG + Intergenic
1138569155 16:57857142-57857164 CACACAGCACACAGGGAGAGTGG - Intronic
1139154420 16:64423481-64423503 CACACACCACACACACCAAGAGG - Intergenic
1140602351 16:76492511-76492533 CAAACACCACACAGAGTAAAAGG + Intronic
1140982026 16:80119638-80119660 CACCCACCACACATATTCAGTGG + Intergenic
1141888888 16:86913182-86913204 CCCACAACACACAGAGAGAGGGG + Intergenic
1143100238 17:4500584-4500606 CACACACAACAGAGAGAGAGAGG + Intronic
1143275234 17:5705416-5705438 CCCACACCCCACAGAGATAGTGG - Intergenic
1143987574 17:10928248-10928270 GACAAACAACACAGAGAAAGGGG + Intergenic
1144397925 17:14863277-14863299 ATCACACCACAGATAGAAATTGG + Intergenic
1144741060 17:17582520-17582542 CACACACCACACACAACAAAGGG + Intronic
1148843242 17:50512632-50512654 CACACACCAATCATAGCTAGAGG - Intronic
1148853037 17:50563921-50563943 CAGATACCACAAAGAGAAAGAGG - Intronic
1151813379 17:76458586-76458608 CACCCACCCCACTTAGCAAGGGG - Intronic
1152318040 17:79592313-79592335 CACACACCACACACATACACAGG - Intergenic
1155074898 18:22346041-22346063 CAAACCCCACAAGTAGAAAGTGG - Intergenic
1156550842 18:38014862-38014884 CATACCACACACAGAGAAAGAGG + Intergenic
1156573853 18:38290215-38290237 CATAAACCAAAGATAGAAAGAGG + Intergenic
1157001867 18:43536712-43536734 CACACACCACACATATCCATTGG - Intergenic
1157224457 18:45849910-45849932 AACACACCAGACATAGAGGGAGG - Exonic
1157410998 18:47463431-47463453 CTCAGACTACACAGAGAAAGGGG - Intergenic
1157765703 18:50295583-50295605 CACACACTACACATAGCAAGGGG + Intergenic
1160527111 18:79544505-79544527 CACCCTCCACACACAGAGAGAGG - Intergenic
1160839260 19:1138260-1138282 CACTCACCCCACACAGAAACAGG + Intronic
1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG + Intergenic
925252912 2:2456318-2456340 CACACATCTCACACAGACAGAGG + Intergenic
928111511 2:28513674-28513696 TACACACCACACAGAGAGTGTGG + Intronic
929390415 2:41462589-41462611 CCCACACCACAGAAAGCAAGGGG + Intergenic
929443822 2:41987523-41987545 CAAACAGAACACATAGATAGAGG - Intergenic
930039422 2:47108744-47108766 CTCACACCGCACATAGAGATGGG + Intronic
930115578 2:47715352-47715374 CAGACACTTCACAAAGAAAGTGG + Intronic
931966843 2:67544428-67544450 AAGACACCACACATAGAAAGAGG + Intergenic
932857819 2:75256068-75256090 CAGACACTAAACATACAAAGAGG - Intergenic
933273285 2:80256609-80256631 CTCACACCAGCCCTAGAAAGCGG + Intronic
933940370 2:87239996-87240018 CACACACCCCACACACACAGTGG - Intergenic
935832112 2:107011050-107011072 CACACCCCACAGATACACAGTGG + Intergenic
936352767 2:111725780-111725802 CACACACCCCACACACACAGTGG + Intergenic
938127402 2:128684555-128684577 CAGAATCAACACATAGAAAGGGG - Intergenic
939307981 2:140432563-140432585 CAAACACCACACTGAGAAACTGG + Intronic
939451819 2:142384250-142384272 CACACAACACACATACACACAGG + Intergenic
941731656 2:168924290-168924312 CACATGCAACACAAAGAAAGAGG - Intronic
944163733 2:196694538-196694560 CACAAACCACACAGAGAAAAGGG + Intronic
1170012043 20:11734804-11734826 CACACATCACACATACACACAGG + Intergenic
1170699342 20:18689287-18689309 CACATAACACACATACAAAGGGG - Intronic
1170877038 20:20259572-20259594 CACACATTAAAAATAGAAAGAGG - Intronic
1170997850 20:21381836-21381858 CACACACCACAAATGTAAAAAGG - Intronic
1171338157 20:24406450-24406472 AACTCACCACAAACAGAAAGAGG - Intergenic
1173326051 20:42034674-42034696 CACACACCACACACATAACTGGG - Intergenic
1174550600 20:51358825-51358847 CCCAAACCACAGCTAGAAAGTGG - Intergenic
1176743469 21:10628881-10628903 CACACACCACACATCCAACATGG + Intergenic
1176884339 21:14236377-14236399 CACATACCACACTCAGTAAGGGG + Intergenic
1179447564 21:41443448-41443470 CACATATTACACATAGAAGGGGG + Intronic
1185154174 22:49183361-49183383 CGCACGACACACACAGAAAGCGG + Intergenic
949916624 3:8969477-8969499 CACACTCCACACACGGCAAGTGG - Intergenic
950272325 3:11627830-11627852 AACATATCACACATTGAAAGAGG + Intronic
952815670 3:37445294-37445316 CACACAACAGAGAAAGAAAGAGG - Intergenic
954235692 3:49255511-49255533 CCCAAAACACACTTAGAAAGAGG - Intronic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
959839434 3:110957382-110957404 CACACACCACATATACATATGGG + Intergenic
959863154 3:111237911-111237933 AACACACCAAACCTTGAAAGTGG + Intronic
960134978 3:114095664-114095686 CTGAGACCACAAATAGAAAGAGG - Intergenic
961914233 3:130354330-130354352 CACAAGCCACATATAGAATGTGG - Intronic
962310645 3:134324540-134324562 AACACACCACACAGGGAACGGGG + Intergenic
962484545 3:135829705-135829727 CAGAAACCACTCAGAGAAAGCGG - Intergenic
962795180 3:138843822-138843844 TATACACCACACACACAAAGAGG + Intergenic
963088528 3:141460690-141460712 CACACCCCACACACACAACGTGG + Intergenic
963467817 3:145704648-145704670 GACACACCATGCCTAGAAAGAGG - Intergenic
965434879 3:168637750-168637772 TACAGCCCACACACAGAAAGTGG - Intergenic
966942660 3:184756765-184756787 CACACACAAGACAGAGAGAGAGG + Intergenic
968487345 4:869840-869862 CACACAGCACACATAGATGCAGG + Intronic
973855183 4:55004274-55004296 CAAACACGAGACATAGAAAGAGG + Intergenic
974125197 4:57687660-57687682 AACACATCACACAGTGAAAGAGG + Intergenic
974309015 4:60179597-60179619 CACACACCCCACATATTCAGTGG - Intergenic
979085283 4:116401496-116401518 CACAACACAAACATAGAAAGAGG + Intergenic
981145342 4:141317499-141317521 CACTCACCAAAAATGGAAAGAGG - Intergenic
986461902 5:7981417-7981439 CACACACCATTCTTAGAAATAGG - Intergenic
986746389 5:10748559-10748581 CACAAACTACACAAAGAGAGTGG + Intronic
987122800 5:14783325-14783347 CACACACCACACATGGAGATAGG + Intronic
987673102 5:21039419-21039441 CACACATCAAACAGAGAAAGTGG + Intergenic
988082236 5:26429158-26429180 CACAAACCATACAAAGAAGGTGG - Intergenic
988569031 5:32345477-32345499 CACACACAGCACATATAAATAGG - Intergenic
990042969 5:51395025-51395047 CACCCACCCCAAATAGGAAGAGG + Intergenic
992500290 5:77335517-77335539 CACACACCCCACATATACACTGG - Intronic
992997990 5:82351071-82351093 CACACCCCAGTAATAGAAAGAGG - Intronic
993409584 5:87556982-87557004 CACACATGAAAAATAGAAAGGGG + Intergenic
994459168 5:100051685-100051707 CACACACCACCCATCCAAAAAGG - Intergenic
999599726 5:153248888-153248910 CTCACACCAAACCTAGAAAAAGG - Intergenic
999700078 5:154219859-154219881 CACACACACCACAGAGAGAGAGG + Intronic
1000087733 5:157902895-157902917 TACACAGCACACAGAGAAAGAGG + Intergenic
1002375145 5:178783397-178783419 CACACACCACACACACACACAGG + Intergenic
1002862783 6:1094963-1094985 CACACACCACACACACACCGGGG + Intergenic
1003157176 6:3606798-3606820 GTCACAGCACACATAGAAACTGG - Intergenic
1003902155 6:10664381-10664403 CACACAAAACCCATAAAAAGTGG - Intergenic
1005138432 6:22598639-22598661 CAGACACCAGACAGAGGAAGTGG + Intergenic
1007060860 6:38939818-38939840 CCCACACCCCATAAAGAAAGTGG + Intronic
1008107942 6:47460538-47460560 CACACCACACACACACAAAGAGG - Intergenic
1008156307 6:48019195-48019217 CACACAGCACAGGTGGAAAGAGG + Intronic
1008860289 6:56141068-56141090 TACACACTAAACATAAAAAGGGG - Intronic
1010934542 6:81845707-81845729 CAGATAACAAACATAGAAAGAGG + Intergenic
1015437730 6:133209103-133209125 CACTCACACCCCATAGAAAGTGG + Intergenic
1018601554 6:165549243-165549265 CACACAACAAACATATAAGGTGG + Intronic
1019510443 7:1414998-1415020 CACACACCAAACACACACAGGGG + Intergenic
1020358875 7:7305835-7305857 CAAACACCAGACACTGAAAGAGG + Intergenic
1021356944 7:19661080-19661102 AACACACCACACAATGAAAGCGG + Intergenic
1021776358 7:24058900-24058922 CACACACCAGGCATAGCATGAGG + Intergenic
1023586174 7:41732144-41732166 CACTCAGCACACACTGAAAGCGG - Intergenic
1023756870 7:43427248-43427270 CACACACAACACACAGAGGGAGG + Intronic
1024175398 7:46835343-46835365 CACACCCCACACTTAGGGAGTGG - Intergenic
1024558649 7:50625219-50625241 CACTCAGGACACATAGAAATTGG - Intronic
1026679435 7:72454359-72454381 CACCCACCAGACACAGAGAGAGG + Intergenic
1027784719 7:82566453-82566475 CACAAACCACACAGATAGAGTGG + Intergenic
1028916216 7:96262302-96262324 CTAACACCAAACAAAGAAAGAGG + Intronic
1029356947 7:100059092-100059114 CACACCACACACATAAATAGTGG - Intronic
1029669826 7:102021920-102021942 CACAATGCACACATAGAAGGAGG - Intronic
1033032060 7:137836864-137836886 CTCACACAAGACATAGAGAGAGG - Intronic
1033115327 7:138619973-138619995 CAGGCACCAGACAGAGAAAGAGG + Intronic
1033588582 7:142792273-142792295 TACACAGGCCACATAGAAAGGGG - Intergenic
1034905204 7:154938738-154938760 CACACACCAGACACAGAAATAGG - Intronic
1035628807 8:1092883-1092905 CCCACACCACACAGTGTAAGTGG - Intergenic
1037124408 8:15328218-15328240 CACATACCACACATTAAAATAGG - Intergenic
1037296421 8:17405871-17405893 CACACACACCACAGAGAAAATGG + Intronic
1037669943 8:21005936-21005958 CACACACCACACACACAGTGGGG + Intergenic
1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG + Intronic
1042020053 8:64363257-64363279 CACACACCACACACTAGAAGGGG + Intergenic
1042437522 8:68784502-68784524 CACAGCCCACACTTAAAAAGTGG + Intronic
1043450317 8:80359863-80359885 CACAGATAACACACAGAAAGAGG + Intergenic
1043636146 8:82385274-82385296 CATCCACCACACATAGAACATGG - Intergenic
1043745113 8:83865478-83865500 CACTCACAACAGAGAGAAAGAGG - Intergenic
1044731164 8:95229627-95229649 CACACACCAAATAAAGAGAGAGG - Intergenic
1047695335 8:127397725-127397747 CACACTCAACAGTTAGAAAGGGG + Intergenic
1049376742 8:142292954-142292976 CACACTCAGCACATAGAAAGTGG + Intronic
1049504367 8:142987783-142987805 CACACCCCACACATGGAATGTGG + Intergenic
1049505787 8:142996887-142996909 CACACTCCTCCCAAAGAAAGAGG - Intergenic
1049737615 8:144218133-144218155 CACACACCACACTAGGATAGGGG - Intronic
1050736219 9:8766221-8766243 CACACACTCCACAAAGACAGTGG - Intronic
1050907633 9:11025930-11025952 CACACAAAACACATAGAATGTGG - Intergenic
1051093993 9:13444062-13444084 CACACAACACACACACAAAGTGG - Intergenic
1053346711 9:37383526-37383548 CACACACATCACACAGGAAGTGG - Intergenic
1054804691 9:69386437-69386459 CACAAACAACACAGAGAGAGAGG - Intronic
1057441034 9:95083489-95083511 CACACACCACACAGAGCACCTGG + Intronic
1057771678 9:97973639-97973661 CATACACCACACACATACAGGGG - Intergenic
1058059080 9:100475838-100475860 CACACACCACACAAAAACACAGG - Intronic
1058270117 9:102961695-102961717 CACCATCCACACAGAGAAAGAGG - Intergenic
1058597062 9:106626541-106626563 CACACAGGAAACAAAGAAAGAGG - Intergenic
1058972457 9:110096048-110096070 CACCCTCCATACATAGAAAAGGG - Intronic
1059027147 9:110647096-110647118 CACACACAACACATACATAATGG + Intergenic
1059571176 9:115437941-115437963 CACACACCCCACATACACACAGG + Intergenic
1059955995 9:119516437-119516459 AACTCCCCAGACATAGAAAGAGG + Intronic
1061815778 9:133194431-133194453 AACACTCCACACATAGGAAGAGG + Intergenic
1185921213 X:4095346-4095368 CACACAAAACACATGAAAAGAGG - Intergenic
1186927008 X:14344591-14344613 CACATCCCACACATTAAAAGTGG - Intergenic
1186981163 X:14959089-14959111 TTCACAACACACAGAGAAAGAGG + Intergenic
1188056693 X:25549319-25549341 TAGAGACCACACAGAGAAAGAGG - Intergenic
1188880482 X:35486216-35486238 CACAGACAACACAAAGAAATGGG + Intergenic
1189174857 X:38945875-38945897 CACACACCACACACACACAATGG - Intergenic
1191860751 X:65665104-65665126 CCCACAACACACATACACAGGGG - Intronic
1192284719 X:69722763-69722785 CAAATCACACACATAGAAAGAGG - Intronic
1192691781 X:73372755-73372777 CACAGACAATACATAGAGAGGGG - Intergenic
1193498568 X:82242492-82242514 CACACACAACACATACATACAGG - Intergenic
1194269223 X:91789358-91789380 CACACACCAAACACACAAACAGG + Intronic
1194793136 X:98176042-98176064 CACACACCTCACCTAGAAAGTGG + Intergenic
1195749327 X:108148541-108148563 CACACACCACCCATGGGAAAAGG + Intronic
1195749367 X:108148915-108148937 AACACAATACAAATAGAAAGTGG - Intronic
1196507445 X:116463781-116463803 AACACATGACACATAGTAAGGGG - Intergenic
1200586441 Y:5010347-5010369 CACACACCAAACACACAAACAGG + Intronic