ID: 1162343171

View in Genome Browser
Species Human (GRCh38)
Location 19:10104751-10104773
Sequence CAACTTAAAGGGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162343165_1162343171 1 Left 1162343165 19:10104727-10104749 CCAAATATGGTCACACACACATC No data
Right 1162343171 19:10104751-10104773 CAACTTAAAGGGAAATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162343171 Original CRISPR CAACTTAAAGGGAAATGGGG TGG Intergenic
No off target data available for this crispr